SubtiWiki SubtiWiki
ylbP
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ylbP
168

putative N-acetyltransferase

locus
BSU_15100
Molecular weight
18.90 kDa
pI
5.88
Protein length
Gene length
function
unknown
product
putative N-acetyltransferase
essential
no
synonyms
ylbP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,576,767 → 1,577,249
The protein
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 7-151) (according to UniProt)
[wiki|Cofactors]
CoA [PDB|2PR1]
Structure
[PDB|2PR1] (in complex with CoA)
Expression and Regulation
Operons
genes
[gene|F86C3CB8387BB4C3FF9F776EA96E6B5AA2503E2C|ylbP]
description
[Pubmed|26673679]
regulation
repressed by glucose (10-fold) ([protein|search|CcpA]) [Pubmed|12850135]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|26673679], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|F86C3CB8387BB4C3FF9F776EA96E6B5AA2503E2C|ylbP]

2020-11-06 12:56:32

ghost

0

ca75970c3671bbb36b75e21c663b8bafbbe03ca0

34BFE5A0964790D87D8E87347A30A65F96A299E5

Biological materials
Mutant
MGNA-B253 (ylbP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1252 NBRP B. subtilis, Japan]
BKE15100 (Δ[gene|F86C3CB8387BB4C3FF9F776EA96E6B5AA2503E2C|ylbP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACAAATCTCCCCCTTTG,  downstream forward: _UP4_TAGAAATCAAAACAACCGGC
BKK15100 (Δ[gene|F86C3CB8387BB4C3FF9F776EA96E6B5AA2503E2C|ylbP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACAAATCTCCCCCTTTG,  downstream forward: _UP4_TAGAAATCAAAACAACCGGC
References
12850135,26673679

F86C3CB8387BB4C3FF9F776EA96E6B5AA2503E2C

Page visits: 1013

Time of last update: 2021-08-04 05:51:17

Author of last update: Melvin.boenninger