SubtiWiki SubtiWiki
dacF
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

dacF
168

Class C penicillin-binding protein I, D-alanyl-D-alanine carboxypeptidase

locus
BSU_23480
Molecular weight
43.13 kDa
pI
9.91
Protein length
Gene length
function
control of peptide cross-linking in spore peptidoglycan
product
penicillin-binding protein I, D-alanyl-D-alanine carboxypeptidase
essential
no
synonyms
dacF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1686

This gene is a member of the following regulons

Gene
Coordinates
2,445,094 → 2,446,263
The protein
Catalyzed reaction/ biological activity
modifies degree of cross-linking of glycan strands in peptidoglycan [pubmed|9864321]
Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)
Protein family
[wiki|Peptidase S11 family] (according to UniProt)
Structure
[PDB|4K91] (from Pseudomonas aeruginosa, 38% identity) [pubmed|23629710]
Paralogous protein(s)
[protein|7C3081BC8D416127A881627EB56C0628359111CF|dacA], [protein|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]
[wiki|Localization]
secreted (via signal peptide) (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]-[gene|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]-[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]-[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
description
[Pubmed|22383849]
regulation
''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]→[gene|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]

2021-08-24 10:13:22

ghost

11

3937ee398a65a809f372c4c59231b1d2e3c32629

AEBA18A2591E8C2953E0D2D62B0F6CD480E5CB2B

Biological materials
Mutant
BKE23480 (Δ[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCAAAAGCCCTCCATT,  downstream forward: _UP4_TAATTATGCCGAATGACCAC
BKK23480 (Δ[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCAAAAGCCCTCCATT,  downstream forward: _UP4_TAATTATGCCGAATGACCAC
References
Reviews
18266855,33709487
Original Publications
16497325,8936302,9864321,12107147,20817675,22123250,23629710,32419322

F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1

Page visits: 1978

Time of last update: 2021-09-14 17:17:28

Author of last update: Jstuelk