SubtiWiki SubtiWiki
rhaR

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

rhaR
168

transcriptional regulator ([wiki|DeoR family]) of the [gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA] operon

locus
BSU_31210
Molecular weight
28.70 kDa
pI
7.37
Protein length
Gene length
function
control of rhamnose utilization
product
transcriptional regulator ([wiki|DeoR family])
essential
no
synonyms
rhaR, yulB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1349

This gene is a member of the following regulons

Gene
Coordinates
3,201,027 → 3,201,803
The protein
[wiki|Domains]
[wiki|HTH deoR-type domain] (aa 3-58) (according to UniProt)
Effectors of protein activity
molecular inducer: rhamnulose-1-phosphate [Pubmed|26712933]
Expression and Regulation
Operons
genes
[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
description
[Pubmed|26712933,22383849]
regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]: repression, [Pubmed|26712933], in [regulon|protein:F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|26712933], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|26712933], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]→[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]

2021-10-21 16:40:05

ghost

10

19fb437091a8b0a4c85dca603a6b54dd43243683

2050B8CB3997650C17442F14F1C06F783D5E7647

genes
[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
description
[Pubmed|22383849]
regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
Open in new tab

[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]→[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]

2021-10-26 02:00:36

ghost

11

f78e9504a24134fdb2f0831248c760840f86c618

D3F58B4ED3CAB9282D2D0E5923C9CC3BE67E3819

Biological materials
Mutant
MGNA-B546 (yulB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1545 NBRP B. subtilis, Japan]
BKE31210 (Δ[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGTAACGCCCTTCCTC,  downstream forward: _UP4_CCTCTTTCGAAGAGAGGGTG
BKK31210 (Δ[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGTAACGCCCTTCCTC,  downstream forward: _UP4_CCTCTTTCGAAGAGAGGGTG
References
26712933,24391637,22383849

F574142C1E61788FF8F4B61280AD4F87292D08DF

Page visits: 1330

Time of last update: 2021-11-17 17:59:05

Author of last update: Melvin.boenninger