SubtiWiki SubtiWiki
rhaR
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rhaR
168

transcriptional regulator ([wiki|DeoR family]) of the [gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA] operon

locus
BSU_31210
Molecular weight
28.70 kDa
pI
7.37
Protein length
Gene length
function
control of rhamnose utilization
product
transcriptional regulator ([wiki|DeoR family])
essential
no
synonyms
rhaR, yulB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1349

This gene is a member of the following regulons

Gene
Coordinates
3,201,027 → 3,201,803
The protein
[wiki|Domains]
[wiki|HTH deoR-type domain] (aa 3-58) (according to UniProt)
Effectors of protein activity
molecular inducer: rhamnulose-1-phosphate [Pubmed|26712933]
Expression and Regulation
Operons
genes
[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
description
[Pubmed|26712933,22383849]
regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]: repression, [Pubmed|26712933], in [regulon|protein:F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|26712933], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|26712933], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]→[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]

2021-07-19 15:18:16

ghost

5

19fb437091a8b0a4c85dca603a6b54dd43243683

2050B8CB3997650C17442F14F1C06F783D5E7647

genes
[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
description
[Pubmed|22383849]
regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
Open in new tab

[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]→[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]

2021-09-01 06:04:13

ghost

6

f78e9504a24134fdb2f0831248c760840f86c618

D3F58B4ED3CAB9282D2D0E5923C9CC3BE67E3819

Biological materials
Mutant
MGNA-B546 (yulB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1545 NBRP B. subtilis, Japan]
BKE31210 (Δ[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGTAACGCCCTTCCTC,  downstream forward: _UP4_CCTCTTTCGAAGAGAGGGTG
BKK31210 (Δ[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGGTAACGCCCTTCCTC,  downstream forward: _UP4_CCTCTTTCGAAGAGAGGGTG
References
26712933,24391637,22383849

F574142C1E61788FF8F4B61280AD4F87292D08DF

Page visits: 1314

Time of last update: 2021-09-06 14:06:01

Author of last update: Melvin.boenninger