SubtiWiki SubtiWiki
rsbRB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rsbRB
168

probably part of the stressosome

locus
BSU_13200
Molecular weight
32.23 kDa
pI
4.79
Protein length
Gene length
function
control of SigB activity
product
RsbR paralog
essential
no
synonyms
rsbRB, ispU, ykoB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1366

This gene is a member of the following regulons

Gene
Coordinates
1,387,206 → 1,388,039
The protein
Catalyzed reaction/ biological activity
negative regulator of [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|ytvA]-dependent light activation of the [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB] stress response [Pubmed|22287516]
[wiki|Domains]
[wiki|STAS domain] (aa 165-276) (according to UniProt)
Structure
[PDB|2MWG] ([protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|ytvA], corresponds to aa 161 ... 273, 34% identity)
Modification
phosphorylation on Thr-186 and probably also on Thr-220 by [protein|ADC52A22950736A0435AEEEC43F7407878786A81|rsbT] [Pubmed|21362065]
Paralogous protein(s)
[protein|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC], [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|rsbR], [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|ytvA], [protein|979D7A45EAD97C99015029400A85795061BAA367|rsbRD]
Expression and Regulation
Operons
genes
[gene|F53C527995909A1CFA72C7BF919DD10EE175C6D7|rsbRB]
description
[Pubmed|22383849]
Open in new tab

[gene|F53C527995909A1CFA72C7BF919DD10EE175C6D7|rsbRB]

2020-11-06 12:56:32

Jstuelk

0

2d93c21218eddb10ec595badaa15cd93d1f5adb9

8B22153DCC4CD6800CB49B836D3F2DED580102A4

Biological materials
Mutant
BKE13200 (Δ[gene|F53C527995909A1CFA72C7BF919DD10EE175C6D7|rsbRB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACACTGCTCCTTTCCC,  downstream forward: _UP4_TAAAAAAATCCGCTATCTGT
BKK13200 (Δ[gene|F53C527995909A1CFA72C7BF919DD10EE175C6D7|rsbRB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACACTGCTCCTTTCCC,  downstream forward: _UP4_TAAAAAAATCCGCTATCTGT
References
15312768,17726680,17726680,17218307,20019076,28271471,28727759

F53C527995909A1CFA72C7BF919DD10EE175C6D7

Page visits: 1344

Time of last update: 2021-09-18 22:15:12

Author of last update: Jstuelk