SubtiWiki SubtiWiki
yndM

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yndM
168

[wiki|sporulation ]protein

locus
BSU_17830
Molecular weight
20.31 kDa
pI
5.64
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yndM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,916,006 → 1,916,545
Expression and Regulation
Operons
genes
[gene|F32542256C5A768A0FE12028669D538A53B033F4|yndM]
description
[Pubmed|22383849]
Open in new tab

[gene|F32542256C5A768A0FE12028669D538A53B033F4|yndM]

2021-10-17 23:54:17

ghost

1

c1815627988ff5d86a05c409648a004b2ae3cb3a

9E954F83A97D52C2C343706A02B4E83F164A6DC4

Biological materials
Mutant
MGNA-B386 (yndM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1385 NBRP B. subtilis, Japan]
BKE17830 (Δ[gene|F32542256C5A768A0FE12028669D538A53B033F4|yndM]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTACTATTTTAAACAG,  downstream forward: _UP4_TAGGAGGCTGTCTTATCGCC
BKK17830 (Δ[gene|F32542256C5A768A0FE12028669D538A53B033F4|yndM]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17830 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTACTATTTTAAACAG,  downstream forward: _UP4_TAGGAGGCTGTCTTATCGCC

F32542256C5A768A0FE12028669D538A53B033F4

Page visits: 836

Time of last update: 2021-11-10 15:09:19

Author of last update: Jstuelk