SubtiWiki SubtiWiki
yflG
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yflG
168

methionine aminopeptidase

locus
BSU_07690
Molecular weight
27.06 kDa
pI
5.58
Protein length
Gene length
function
removal of N-terminal methionine from nascent proteins
product
methionine aminopeptidase
essential
no
synonyms
yflG, mapB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0024

This gene is a member of the following regulons

Gene
Coordinates
839,735 → 840,484
The protein
Catalyzed reaction/ biological activity
Release of N-terminal amino acids, preferentially methionine, from peptides and arylamides (according to UniProt)
Protein family
peptidase M24A family (with [protein|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map], according to UniProt)
Structure
[PDB|1QXW] (from Staphylococcus aureus, 51% identity) [pubmed|14998322]
Paralogous protein(s)
[protein|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]-[gene|FB3A0E7A2428AA374C844C26464FAF8D40ADF142|yflH]-[gene|2BD3B1B122C902C01C88C97F0D5CD20962C9676B|yflI]
description
[Pubmed|22383849,16207374]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
regulatory mechanism
[protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]: repression, (weak and not certain) [Pubmed|16207374], in [regulon|protein:6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16207374], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]→[gene|2BD3B1B122C902C01C88C97F0D5CD20962C9676B|yflI]

2021-08-23 14:09:17

Jstuelk

6

c1614d2c9c5978531b016f43a531f140bbd19647

EE6EE6B0D0F1E44D02EEBF60829D3001D9844453

Biological materials
Mutant
MGNA-C255 (yflG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2253 NBRP B. subtilis, Japan]
BKE07690 (Δ[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCATTCCCGCTTTC,  downstream forward: _UP4_TAAAACACATTCCGGGCTTC
BKK07690 (Δ[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCATTCCCGCTTTC,  downstream forward: _UP4_TAAAACACATTCCGGGCTTC
References
16207374,14998322

F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16

Page visits: 1154

Time of last update: 2021-09-14 14:24:43

Author of last update: Melvin.boenninger