SubtiWiki SubtiWiki
yqfU
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqfU
168

unknown

locus
BSU_25110
Molecular weight
32.31 kDa
pI
6.26
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yqfU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1284

This gene is a member of the following regulons

Gene
Coordinates
2,592,003 → 2,592,884
The protein
Protein family
[wiki|UPF0750 membrane proteins] (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]-[gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]
description
[Pubmed|22383849]
Open in new tab

[gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]→[gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]

2021-09-04 13:50:08

Jstuelk

4

ac60bd45458950d863054ce20cc2dd96eb965f7a

70C58CD30FD55FB5EE42DD20610C4696D9D314B6

Biological materials
Mutant
MGNA-C421 (yqfU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2419 NBRP B. subtilis, Japan]
BKE25110 (Δ[gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAATCTCCTTTCCTGC,  downstream forward: _UP4_TAGGCTTTCATTTACTTTTA
BKK25110 (Δ[gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAATCTCCTTTCCTGC,  downstream forward: _UP4_TAGGCTTTCATTTACTTTTA
References
12486072

F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24

Page visits: 728

Time of last update: 2021-08-30 16:51:36

Author of last update: Melvin.boenninger