SubtiWiki SubtiWiki
mccA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mccA
168

O-acetylserine-thiol-lyase

locus
BSU_27260
Molecular weight
32.86 kDa
pI
5.23
Protein length
Gene length
function
methionine-to-cysteine conversion
product
O-acetylserine-thiol-lyase
essential
no
synonyms
mccA, yrhA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0031

This gene is a member of the following regulons

Gene
Coordinates
2,786,142 → 2,787,065
Phenotypes of a mutant
a [gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA] [gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK] double mutant is auxotrophic for cysteine [pubmed|17056751]
The protein
Catalyzed reaction/ biological activity
L-homocysteine + O-acetyl-L-serine --> acetate + H+ + L,L-cystathionine (according to UniProt)
Protein family
Cysteine synthase/cystathionine beta-synthase family (with [protein|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK] and [protein|6F1462EA074DEDE2FEF13561A6691A22BFAD10FE|ytkP], according to UniProt)
[wiki|Cofactors]
PLP (according to UniProt)
Structure
[PDB|4QL4] (from B. anthracis, 63% identity)
Paralogous protein(s)
[protein|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK], [protein|6F1462EA074DEDE2FEF13561A6691A22BFAD10FE|ytkP]
[wiki|Localization]
cytoplasm (according to UniProt)
Expression and Regulation
Operons
genes
[gene|992A24CF9492965BF0E9EEFBB6F0A06871275068|yrrT]-[gene|5B21D1E73A65B13CE4DDA32ABC71EFA54E8D1D8F|mtnN]-[gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA]-[gene|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|mccB]-[gene|177EFFDCA6E3C3BB840EED13D9F2D71F99B833B6|yrhC]
description
[Pubmed|17056751]
regulation
repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: repression, [Pubmed|16513748], in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, [Pubmed|12642660,16885442], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16513748], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|992A24CF9492965BF0E9EEFBB6F0A06871275068|yrrT]→[gene|177EFFDCA6E3C3BB840EED13D9F2D71F99B833B6|yrhC]

2021-08-22 21:47:17

ghost

6

520f018506caa674deba5a8750946c81db19309b

6F8866D3B9D23886BC36B8964568BAC6D245EA17

Biological materials
Mutant
MGNA-A849 (yrhA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/849 NBRP B. subtilis, Japan]
1A945 ( ''mccA''::''kan''), [Pubmed|17056751], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A945&Search=1A945 BGSC]
BKE27260 (Δ[gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATGTCCTCCTCCTTA,  downstream forward: _UP4_CAAATATACGAAGGAGGCAT
BKK27260 (Δ[gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATATGTCCTCCTCCTTA,  downstream forward: _UP4_CAAATATACGAAGGAGGCAT
References
17056751,16513748,16885442,12642660

F195C47849F4F6B4C56E3A386F5D8C84326B01C4

Page visits: 1409

Time of last update: 2021-09-18 21:55:24

Author of last update: Melvin.boenninger