SubtiWiki SubtiWiki
secDF

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

secDF
168

preprotein translocase subunit (ATPase)

locus
BSU_27650
Molecular weight
81.47 kDa
pI
9.52
Protein length
Gene length
function
protein secretion
product
preprotein translocase subunit (ATPase)
essential
no
synonyms
secDF, secF, secD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0342

This gene is a member of the following regulons

Gene
Coordinates
2,826,900 → 2,829,113
Phenotypes of a mutant
reduced [wiki|protein secretion] [pubmed|32111210]
The protein
Protein family
N-terminal part: SecD/SecF family (single member, according to UniProt)
C-terminal part: SecD/SecF family (single member, according to UniProt)
Structure
[PDB|5XAN] (from Deinococcus radiodurans, 32% identity) [pubmed|28467902]
[wiki|Localization]
membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|comN]-[gene|F0E7B6E000A5B06C9023C76F21551E754C8C45BA|secDF]
description
[pubmed|22383849]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
Open in new tab

[gene|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|comN]->[gene|F0E7B6E000A5B06C9023C76F21551E754C8C45BA|secDF]

2021-10-04 01:51:19

Bzhu

3

c394b904979c4c093d9b6e81901fe4d43db37ff3

4A6269F7B3E939FAE1E8CF427D8A743BEE07648E

Biological materials
Mutant
MGNA-B519 (yrvB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1518 NBRP B. subtilis, Japan]
SM-GN3 (''secDF-spc''), available in [wiki|Anne Galinier]'s and [wiki|Boris Görke]'s labs
BKE27650 (Δ[gene|F0E7B6E000A5B06C9023C76F21551E754C8C45BA|secDF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATGTATATCCTCCCTT,  downstream forward: _UP4_TAAAAAATATCAGGCTGTCC
BKK27650 (Δ[gene|F0E7B6E000A5B06C9023C76F21551E754C8C45BA|secDF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATGTATATCCTCCCTT,  downstream forward: _UP4_TAAAAAATATCAGGCTGTCC
References
Reviews
25212246
Original Publications
18763711,15995216,18179421,28467902,32111210

F0E7B6E000A5B06C9023C76F21551E754C8C45BA

Page visits: 1367

Time of last update: 2021-10-16 04:07:27

Author of last update: Jstuelk