SubtiWiki SubtiWiki
yojN
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yojN
168

similar to nitric-oxide reductase

locus
BSU_19390
Molecular weight
33.33 kDa
pI
4.95
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yojN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0714

This gene is a member of the following regulons

Gene
Coordinates
2,113,764 → 2,114,678
The protein
Protein family
CbbQ/NirQ/NorQ/GpvN family (single member, according to UniProt)
Structure
[PDB|5C3C] (from  Halothiobacillus neapolitanus, aa 70 - 304, 26% identity) [pubmed|26538283]
Expression and Regulation
Operons
genes
[gene|F0C1FD1038E218AE73405F510F3AB4BF13D0A6BB|yojN]-[gene|7C906AE08767CD81305F9B0EB8491E1E4208262E|yojO]
description
[Pubmed|22383849]
Open in new tab

[gene|F0C1FD1038E218AE73405F510F3AB4BF13D0A6BB|yojN]→[gene|7C906AE08767CD81305F9B0EB8491E1E4208262E|yojO]

2021-08-08 21:15:15

Jstuelk

1

474b970b3f2ba9444acb326adc99063381f6d315

6F5DD1CE8D3E4965D415D88995ED11EE9633752D

Biological materials
Mutant
MGNA-B422 (yojN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1421 NBRP B. subtilis, Japan]
BKE19390 (Δ[gene|F0C1FD1038E218AE73405F510F3AB4BF13D0A6BB|yojN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCCATTAACGAGTAT,  downstream forward: _UP4_CGAAATATTGCAGAAACTCTG
BKK19390 (Δ[gene|F0C1FD1038E218AE73405F510F3AB4BF13D0A6BB|yojN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTCCATTAACGAGTAT,  downstream forward: _UP4_CGAAATATTGCAGAAACTCTG
References
Research papers
26538283

F0C1FD1038E218AE73405F510F3AB4BF13D0A6BB

Page visits: 861

Time of last update: 2021-09-13 15:11:21

Author of last update: Melvin.boenninger