SubtiWiki SubtiWiki
yhjC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhjC
168

unknown

locus
BSU_10460
Molecular weight
7.25 kDa
pI
7.01
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yhjC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,120,628 → 1,120,828
Expression and Regulation
Operons
genes
[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]-[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]
description
[Pubmed|22383849]
regulation
repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
Open in new tab

[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]→[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]

2021-08-21 19:52:13

ghost

4

e20d4e174d61c1f90f304dae861aa32cc0a1c796

ED93356459DED90EC724658D042C236394200D75

Biological materials
Mutant
BKE10460 (Δ[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCCTCCTTCTATT,  downstream forward: _UP4_GAAAATAAAAAGGAGGAAGC
BKK10460 (Δ[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCCTCCTTCTATT,  downstream forward: _UP4_GAAAATAAAAAGGAGGAAGC
References
18083814,12618455,22383849,11948146

F093B021240236AA938C6336AA0B8DC37839F569

Page visits: 1218

Time of last update: 2021-09-18 22:01:25

Author of last update: Bzhu