SubtiWiki SubtiWiki
spmA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spmA
168

spore maturation protein (spore core dehydratation)

locus
BSU_23180
Molecular weight
21.35 kDa
pI
10.03
Protein length
Gene length
function
germination
product
spore maturation protein (spore core dehydratation)
essential
no
ec
null
synonyms
spmA, ypuJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2715

This gene is a member of the following regulons

Gene
Coordinates
2,422,805 → 2,423,395
The protein
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]-[gene|F00DAFFBB136F9331C47D45BF44DC59E3EBB75FA|spmA]-[gene|6AFED2DBF443D3E7FECE211BF8FCF1FD33B7104D|spmB]
description
[Pubmed|7642500]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,7528199]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,7528199], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]→[gene|6AFED2DBF443D3E7FECE211BF8FCF1FD33B7104D|spmB]

2021-09-18 05:56:02

ghost

7

7b91c54260f7f0e53a5c4144c6ab48e405116b3d

C9960B306C3A092D8114C6E83F0241527A83EB89

Biological materials
Mutant
MGNA-A002 (spmA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2 NBRP B. subtilis, Japan]
BKE23180 (Δ[gene|F00DAFFBB136F9331C47D45BF44DC59E3EBB75FA|spmA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTATATTGACCATTTTGC,  downstream forward: _UP4_CGCAAAAAGAAGGGAAGGTG
BKK23180 (Δ[gene|F00DAFFBB136F9331C47D45BF44DC59E3EBB75FA|spmA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATTATATTGACCATTTTGC,  downstream forward: _UP4_CGCAAAAAGAAGGGAAGGTG
References
7642500,7528199,15699190

F00DAFFBB136F9331C47D45BF44DC59E3EBB75FA

Page visits: 1260

Time of last update: 2021-09-18 05:55:58

Author of last update: Melvin.boenninger