SubtiWiki SubtiWiki
yvcD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvcD
168

unknown

locus
BSU_34810
Molecular weight
55.21 kDa
pI
4.68
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yvcD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,576,165 → 3,577,619
The protein
[wiki|Domains]
three [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Expression and Regulation
Operons
genes
[gene|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|bmrA]-[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]
description
[pubmed|22383849]
regulation
constitutively expressed [Pubmed|21077936]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21077936], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
half-life of the mRNA: 1.5 min [PubMed|21077936]
Open in new tab

[gene|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|bmrA]->[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]

2021-09-15 18:17:01

Bzhu

3

cbb28df201cbb41f921589502974e179e1c5f328

D27A0048010333EF6A841E0CD3BADFB4A82AC446

Biological materials
Mutant
MGNA-B644 (yvcD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1643 NBRP B. subtilis, Japan]
BKE34810 (Δ[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAACTACCCTCCGTTTTA,  downstream forward: _UP4_TAGTAAATTTTAAAGAGTTG
BKK34810 (Δ[gene|EFF0635A4BBB62558A04BA49195D76234776F943|yvcD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAACTACCCTCCGTTTTA,  downstream forward: _UP4_TAGTAAATTTTAAAGAGTTG
References
16479537

EFF0635A4BBB62558A04BA49195D76234776F943

Page visits: 1406

Time of last update: 2021-09-15 17:00:21

Author of last update: Jstuelk