SubtiWiki SubtiWiki
yhjB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhjB
168

similar to metabolite permease

locus
BSU_10450
Molecular weight
52.60 kDa
pI
9.63
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yhjB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0591

This gene is a member of the following regulons

Gene
Coordinates
1,119,162 → 1,120,631
The protein
Protein family
[wiki|sodium:solute symporter (SSF) (TC 2.A.21) family] (according to UniProt)
Paralogous protein(s)
[protein|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]
Expression and Regulation
Operons
genes
[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]-[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]
description
[Pubmed|22383849]
regulation
repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
Open in new tab

[gene|F093B021240236AA938C6336AA0B8DC37839F569|yhjC]→[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]

2021-08-21 19:52:13

ghost

4

e20d4e174d61c1f90f304dae861aa32cc0a1c796

ED93356459DED90EC724658D042C236394200D75

Biological materials
Mutant
GP2395 Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::tet available in [wiki|Jörg Stülke]'s lab [pubmed|32743959]
MGNA-B283 (yhjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1282 NBRP B. subtilis, Japan]
BKE10450 (Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCATTCTGCTTCCTCCTT,  downstream forward: _UP4_TAAGCATAAAAAAAGCAATC
BKK10450 (Δ[gene|EFA18ACD034D48868CD97470F81F23976DA300DF|yhjB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCATTCTGCTTCCTCCTT,  downstream forward: _UP4_TAAGCATAAAAAAAGCAATC
References
11948146,22383849

EFA18ACD034D48868CD97470F81F23976DA300DF

Page visits: 1148

Time of last update: 2021-08-07 13:29:26

Author of last update: Jstuelk