SubtiWiki SubtiWiki
dppC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

dppC
168

dipeptide [protein|search|ABC transporter] (permease)

locus
BSU_12940
Molecular weight
35.65 kDa
pI
9.81
Protein length
Gene length
function
uptake of dipeptides
product
dipeptide [wiki|ABC transporter] (permease)
essential
no
synonyms
dppC, dciAC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1173

This gene is a member of the following regulons

Gene
Coordinates
1,362,174 → 1,363,136
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|OppBC subfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 117-307) (according to UniProt)
Paralogous protein(s)
[protein|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC], [protein|DDBCE73B6AF39E5D669475479186C93F287DA9FC|oppC]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]
description
[Pubmed|1766371]
regulation
repressed by glucose (2.9-fold) [Pubmed|12850135]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|7783641], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1766371], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]→[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]

2021-08-05 22:15:11

Jstuelk

3

09ee4083370400f9df0298a2b88ab5c0bbf1df43

5AB4A35A00613327500FE4CC530C2BFA97A6C07B

genes
[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]-[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]-[gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]-[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]-[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
description
[pubmed|22383849]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]->[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]

2021-08-16 14:15:17

Bzhu

6

9978370314fc05087eca13c4f3ce94e92ce93ff2

E2A0CC9BE866DBD9F0E3A5F48EE05465C14EFD9D

Biological materials
Mutant
BKE12940 (Δ[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGTACAGGGAGATTCACAC,  downstream forward: _UP4_GACCCTAAGCTGAGGAGGTA
BKK12940 (Δ[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGTACAGGGAGATTCACAC,  downstream forward: _UP4_GACCCTAAGCTGAGGAGGTA
References
12618455,10092453,1766371,7783641,1766371

EDF8D2C49FA5552B24135E12524F9035E1E01473

Page visits: 2079

Time of last update: 2021-09-15 10:13:39

Author of last update: Melvin.boenninger