SubtiWiki SubtiWiki
cmoO
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cmoO
168

monooxygenase, required for the conversion of S-methyl-cysteine to cysteine

locus
BSU_29330
Molecular weight
36.79 kDa
pI
5.84
Protein length
Gene length
function
utilization of S-methyl-cysteine
product
monooxygenase
essential
no
synonyms
cmoO, ytmO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2141

This gene is a member of the following regulons

Gene
Coordinates
3,003,345 → 3,004,349
Phenotypes of a mutant
no growth with S-methyl cysteine [Pubmed|23944997]
The protein
Protein family
Flavin-utilizing monoxygenases
Structure
[PDB|4US5] (from Streptomyces bottropensis, 31% identity) [pubmed|24554499]
Paralogous protein(s)
[protein|A1DCFF8D225C87197104742E72A0D4F238BC30EB|ywcH], [protein|A36E7D50E2EBD0F0109491FF2CAD2CA84372B2CF|yvbT]
[protein|1432F56AD3D2B2BD82D8759CE4DC42C0D40C49C0|yceB], (37,4%)
Expression and Regulation
Operons
genes
[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]-[gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]-[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]-[gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]-[gene|B1DD32A3B3D1C0C5391A40834940257357A2F30F|tcyM]-[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]-[gene|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|cmoO]-[gene|FCD25CA4414D689B217F54B0C44EB805F9590454|cmoI]-[gene|8145952307BC47805A7A9BD39418474358043BFE|cmoJ]-[gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]-[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]-[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]
description
[Pubmed|15668000]
regulation
induced in the presence of methionine and taurine [Pubmed|11390694]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: repression, [Pubmed|16109943], in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
[protein|741156D495BE3857683C8A0390764EAD83845ABC|ascR]: activation, [Pubmed|16109943], in [regulon|protein:741156D495BE3857683C8A0390764EAD83845ABC|ascR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15272571], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]→[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]

2021-06-26 13:56:31

Jstuelk

6

8a3868e633778d2f68bf47d615f22f716e843294

4D6CA410A1DC104A491D3C18248CCD50CC0E983A

Biological materials
Mutant
MGNA-A174 (ytmO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/174 NBRP B. subtilis, Japan]
BKE29330 (Δ[gene|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|cmoO]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGGTCTAAAATACTTAAGC,  downstream forward: _UP4_AAACGTTAAGGAGGGACAGA
BKK29330 (Δ[gene|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|cmoO]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGGTCTAAAATACTTAAGC,  downstream forward: _UP4_AAACGTTAAGGAGGGACAGA
References
16109943,15668000,15272571,23944997,24554499

EDC3565D90D7059A4A4C66A13EB568420F6CECD4

Page visits: 1682

Time of last update: 2021-09-18 14:10:18

Author of last update: Bzhu