SubtiWiki SubtiWiki
ylbD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ylbD
168

outer spore coat protein

locus
BSU_14970
Molecular weight
15.14 kDa
pI
7.38
Protein length
Gene length
function
protection of the spore
product
spore coat protein
essential
no
ec
null
synonyms
ylbD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5892

This gene is a member of the following regulons

Gene
Coordinates
1,567,651 → 1,568,049
The protein
[wiki|Localization]
outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|cotE]  [Pubmed|22171814]
Expression and Regulation
Operons
genes
[gene|ECD40F139D57B159A54E660ABD0D92629490AE8D|ylbD]-[gene|C7FDE0BE621C48E2F8D7B00532403CA7D8B44660|ylbE]
description
[Pubmed|22383849]
regulation
expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15699190,15383836]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: activation, [Pubmed|15383836], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|ECD40F139D57B159A54E660ABD0D92629490AE8D|ylbD]→[gene|C7FDE0BE621C48E2F8D7B00532403CA7D8B44660|ylbE]

2021-07-08 09:07:25

ghost

3

2d327cc46be4794b024b6341c87b44ad07198b33

A3980987B7AF5097C9E476860FA547988129597E

Biological materials
Mutant
MGNA-B359 (ylbD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1358 NBRP B. subtilis, Japan]
BKE14970 (Δ[gene|ECD40F139D57B159A54E660ABD0D92629490AE8D|ylbD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAATCCTCACCCCCTCCG,  downstream forward: _UP4_AAGGATTAAAAAAGGGGAGC
BKK14970 (Δ[gene|ECD40F139D57B159A54E660ABD0D92629490AE8D|ylbD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAATCCTCACCCCCTCCG,  downstream forward: _UP4_AAGGATTAAAAAAGGGGAGC
References
15699190,15383836,22171814,22383849

ECD40F139D57B159A54E660ABD0D92629490AE8D

Page visits: 983

Time of last update: 2021-09-13 20:38:48

Author of last update: Bzhu