SubtiWiki SubtiWiki
ilvC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ilvC
168

ketol-acid reductoisomerase (2,3-dihydroxy-3-methylbutanoate, 2-acetolactate)

locus
BSU_28290
Molecular weight
37.30 kDa
pI
5.37
Protein length
Gene length
function
biosynthesis of branched-chain amino acids
product
ketol-acid reductoisomerase (2,3-dihydroxy-3-methylbutanoate, 2-acetolactate)
essential
no
ec
1.1.1.86
synonyms
ilvC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0059

This gene is a member of the following regulons

Gene
Coordinates
2,893,681 2,894,709
The protein
Catalyzed reaction/ biological activity
(2R)-2,3-dihydroxy-3-methylbutanoate + NADP+ --> (2S)-2-acetolactate + H+ + NADPH (according to UniProt)
(2R,3R)-2,3-dihydroxy-3-methylpentanoate + NADP+ --> (S)-2-ethyl-2-hydroxy-3-oxobutanoate + H+ + NADPH (according to UniProt)
Protein family
ketol-acid reductoisomerase family (single member, according to UniProt)
[wiki|Domains]
KARI N-terminal Rossmann domain (aa 2-181) (according to UniProt)
KARI C-terminal knotted domain (aa 182-327) (according to UniProt)
Structure
[PDB|1NP3] (from ''Escherichia coli'', 53% identity, 71% similarity) [Pubmed|12691757]
Modification
phosphorylated on Arg-298 [Pubmed|22517742]
phosphorylated on Ser-338 [Pubmed|20509597]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]-[gene|49E2D2EE480C2FFDED0C35E3AF0DBED5AD819B5F|ilvH]-[gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]-[gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA]-[gene|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB]-[gene|AC459429A9C50463FD947C1CF9EA919B6FE3B335|leuC]-[gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]
description
[Pubmed|1577690]
regulation
expression is stimulated in the presence of glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [PubMed|12193635]
regulatory mechanism
T-box: termination/antitermination, via tRNA controlled [wiki|RNA switch], repression by BCAA, in [regulon|other_regulator:T-box|T-box]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|15547269], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: activation, [Pubmed|12193635], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1577690], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An [wiki|ncRNA|antisense RNA] is predicted for [gene|1502AED337F59DFFCEAFF68FE111C5AA6155701B|leuA] [PubMed|20525796]
the [wiki|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
Open in new tab

[gene|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|ilvB]→[gene|0EB4C6EE398B14B9284FFAEDBC26C866CE2070D7|leuD]

2021-07-07 11:10:26

Jstuelk

5

905a0fc4b9e1945f65cf0820ea8bda45e4ac716c

931C13BE07545B8037A118810CF4C8E29210A7CE

Biological materials
Mutant
BKE28290 ([gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATCTCTCCCTTGT, downstream forward: _UP4_AAGAAGAAGGAAGCGGTGGT
BKK28290 ([gene|EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57|ilvC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATCTCTCCCTTGT, downstream forward: _UP4_AAGAAGAAGGAAGCGGTGGT
lacZ fusion
pGP521 (in [wiki|pAC5]), available in [wiki|Jrg Stlke]'s lab
References
24163341,15060025,12193635,19258532,8289305,18641142,20935095,15547269,12618455,12107147,20509597,22517742,15378759,25755103,25157083,26220295,28516784

EC1CB2FD563EFDA391D13EB8ADFDC8C9734E9D57

Page visits: 1874

Time of last update: 2021-09-16 16:30:51

Author of last update: Melvin.boenninger