SubtiWiki SubtiWiki
yitA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yitA
168

sulfate adenylyltransferase

locus
BSU_10920
Molecular weight
43.09 kDa
pI
7.55
Protein length
Gene length
function
sulfate reduction and activation
product
sulfate adenylyltransferase
essential
no
ec
2.7.7.4
synonyms
yitA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2046

This gene is a member of the following regulons

Gene
Coordinates
1,170,473 → 1,171,642
The protein
Catalyzed reaction/ biological activity
ATP + H+ + sulfate --> adenosine 5'-phosphosulfate + diphosphate (according to UniProt)
Protein family
sulfate adenylyltransferase family (with [protein|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat], according to UniProt)
Structure
[PDB|1R6X] (from yeast, 41% identity) [pubmed|14983089]
Paralogous protein(s)
[protein|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]
Expression and Regulation
Operons
genes
[gene|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|yitB]-[gene|EBBA4432FF83B6F203C694E04111D45290BE157A|yitA]-[gene|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|yisZ]
description
[Pubmed|22383849]
regulation
expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
sigma factors
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
Open in new tab

[gene|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|yitB]→[gene|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|yisZ]

2021-08-26 15:13:27

ghost

2

4fca3e0835090887f1ca8f30217e3a4a8ad039c1

C607370DEEFC425F067119B36C7AC0A95C3ADF71

Biological materials
Mutant
MGNA-A500 (yitA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/500 NBRP B. subtilis, Japan]
BKE10920 (Δ[gene|EBBA4432FF83B6F203C694E04111D45290BE157A|yitA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGTGTTCAACCTCCATT,  downstream forward: _UP4_AAGCAAAACAGCGGGGAATT
BKK10920 (Δ[gene|EBBA4432FF83B6F203C694E04111D45290BE157A|yitA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGTGTTCAACCTCCATT,  downstream forward: _UP4_AAGCAAAACAGCGGGGAATT
References
15699190,15383836,14983089

EBBA4432FF83B6F203C694E04111D45290BE157A

Page visits: 1293

Time of last update: 2021-08-31 23:50:47

Author of last update: Melvin.boenninger