SubtiWiki SubtiWiki
yvdE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvdE
168

similar to transcriptional regulator ([wiki|LacI family]), probably regulator of starch and maltodextrin utilization

locus
BSU_34630
Molecular weight
35.28 kDa
pI
7.09
Protein length
Gene length
function
probably regulation of starch and maltodextrin utilization
product
transcriptional regulator ([wiki|LacI family])
essential
no
synonyms
yvdE, mdxR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1609

This gene is a member of the following regulons

Gene
Coordinates
3,557,784 → 3,558,734
The protein
Protein family
[wiki|LacI family]
[wiki|Domains]
[wiki|HTH lacI-type domain] (aa 1-56) (according to UniProt)
Structure
[PDB|5YSZ] (from Thermobifida fusca, 30% identity) [pubmed|30062758]
Expression and Regulation
Operons
genes
[gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]-[gene|A577441DE4ABAF624D507DB80FBED2A652BCF385|yvdF]-[gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]-[gene|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|mdxF]-[gene|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|mdxG]-[gene|68C6FD5D4D9491EE15A5015447959A45C36EA702|yvdJ]-[gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]-[gene|6E5AB4620F9A896C32CD77AF314C67035814AE0A|malL]-[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]
description
[Pubmed|16707683]
regulation
induced in the presence of maltose [Pubmed|9573215]
Open in new tab

[gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]→[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]

2021-07-22 09:31:39

ghost

6

875dd090fab06d126bf7206081d457b6a5e12492

6EDA4FDB63800BE601694138B9C35457B6878679

Biological materials
Mutant
BKE34630 (Δ[gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCTCCTTAT,  downstream forward: _UP4_TAAGCGCCTTATTCTGTTAT
BKK34630 (Δ[gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCTCCTTAT,  downstream forward: _UP4_TAAGCGCCTTATTCTGTTAT
References
16707683,30062758

EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A

Page visits: 1066

Time of last update: 2021-09-18 10:09:16

Author of last update: Melvin.boenninger