SubtiWiki SubtiWiki
speB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

speB
168

agmatinase

locus
BSU_37490
Molecular weight
32.26 kDa
pI
4.77
Protein length
Gene length
function
spermidine, polyamine biosynthesis
product
agmatinase
essential
no
ec
3.5.3.11
synonyms
speB, ywhG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0010

This gene is a member of the following regulons

Gene
Coordinates
3,847,853 → 3,848,725
The protein
Catalyzed reaction/ biological activity
agmatine + H2O --> putrescine + urea (according to UniProt)
Protein family
arginase family (with [protein|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF] and [protein|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG], according to UniProt)
Structure
[PDB|3LHL] (from Clostridium difficile, 41% identity)
Expression and Regulation
Operons
genes
[gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]-[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]
description
[Pubmed|9723923]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9723923], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]→[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]

2021-07-21 18:38:10

ghost

4

d104eda79cf11caf258634033505649022ae60e1

8EB1957F1B9995E8C2AE0C77629FFC2A59CB591F

Biological materials
Mutant
MGNA-A522 (ywhG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/522 NBRP B. subtilis, Japan]
BKE37490 (Δ[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATACCCTCGCTT,  downstream forward: _UP4_TAAGTAAACATCCAGACGAT
BKK37490 (Δ[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATACCCTCGCTT,  downstream forward: _UP4_TAAGTAAACATCCAGACGAT
References
9723923

EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07

Page visits: 930

Time of last update: 2021-09-06 12:59:27

Author of last update: Melvin.boenninger