SubtiWiki SubtiWiki
speB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

speB
168

agmatinase

locus
BSU_37490
Molecular weight
32.26 kDa
pI
4.77
Protein length
Gene length
function
spermidine, polyamine biosynthesis
product
agmatinase
essential
no
ec
3.5.3.11
synonyms
speB, ywhG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0010

This gene is a member of the following regulons

Gene
Coordinates
3,847,853 → 3,848,725
The protein
Catalyzed reaction/ biological activity
agmatine + H2O --> putrescine + urea (according to UniProt)
Protein family
arginase family (with [protein|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF] and [protein|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG], according to UniProt)
Structure
[PDB|3LHL] (from Clostridium difficile, 41% identity)
Expression and Regulation
Operons
genes
[gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]-[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]
description
[Pubmed|9723923]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9723923], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]→[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]

2021-11-24 01:42:38

ghost

9

d104eda79cf11caf258634033505649022ae60e1

8EB1957F1B9995E8C2AE0C77629FFC2A59CB591F

Biological materials
Mutant
MGNA-A522 (ywhG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/522 NBRP B. subtilis, Japan]
BKE37490 (Δ[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATACCCTCGCTT,  downstream forward: _UP4_TAAGTAAACATCCAGACGAT
BKK37490 (Δ[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATACCCTCGCTT,  downstream forward: _UP4_TAAGTAAACATCCAGACGAT
References
9723923

EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07

Page visits: 947

Time of last update: 2021-12-01 06:37:00

Author of last update: Melvin.boenninger