SubtiWiki SubtiWiki
oatA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

oatA
168

O-acetyl transferase, provides resistance to lysozyme

locus
BSU_27140
Molecular weight
72.04 kDa
pI
9.45
Protein length
Gene length
function
resistance to lysozyme
product
O-acetyl transferase
essential
no
synonyms
oatA, yrhL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1835

This gene is a member of the following regulons

Gene
Coordinates
2,771,318 → 2,773,222
Phenotypes of a mutant
increased sensitivity to lysozyme [Pubmed|21856855]
The protein
Protein family
Acyltransferase 3 family (with [protein|A408883503931320B1BC04F38E6D475530518A25|yfiQ] and [protein|07A53089107037359C428549FF877638B90CF074|ykrP], according to UniProt)
Structure
[PDB|6VJP] (from Staphylococcus aureus, C-terminal extracytoplasmic domain) [pubmed|32350117]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]-[gene|ED1DDA187692683D9862EC0E858B80CD56C48045|rsiV]-[gene|E97C7A219DB059BB634E893CC355A28324C87ADB|oatA]-[gene|FC37C7A0C0D9F50CA1D44B8D939CF06E210D4B38|yrhK]
description
[Pubmed|21856855]
regulation
induced by lysozyme ([protein|search|SigV]) [Pubmed|21856855]
sigma factors
[protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]: sigma factor, [Pubmed|21856855], in [regulon|protein:D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV regulon]
additional information
A [protein|search|ncRNA] ([wiki|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
Open in new tab

[gene|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]→[gene|FC37C7A0C0D9F50CA1D44B8D939CF06E210D4B38|yrhK]

2021-10-17 16:07:00

ghost

14

615f2fda44a94485d48484b2f1ca14b4c127fd7e

083DE19EDE6E0BC14CEE435D7EC2FFBFBF00CE42

Biological materials
Mutant
MGNA-A146 (yrhL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/146 NBRP B. subtilis, Japan]
BKE27140 (Δ[gene|E97C7A219DB059BB634E893CC355A28324C87ADB|oatA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATTCCTCCAATAG,  downstream forward: _UP4_TAAAAAAGAGATCCTATACA
BKK27140 (Δ[gene|E97C7A219DB059BB634E893CC355A28324C87ADB|oatA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATTCCTCCAATAG,  downstream forward: _UP4_TAAAAAAGAGATCCTATACA
References
Research papers
32350117,21856855,25790031

E97C7A219DB059BB634E893CC355A28324C87ADB

Page visits: 1496

Time of last update: 2021-10-21 09:01:47

Author of last update: Jstuelk