SubtiWiki SubtiWiki
licA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

licA
168

lichenan-specific permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIA of the [category|SW.1.2.2|PTS]

locus
BSU_38570
Molecular weight
12.04 kDa
pI
4.64
Protein length
Gene length
function
lichenan uptake and phosphorylation
product
lichenan-specific [category|SW.1.2.2|PTS], EIIA component
essential
no
synonyms
licA, celC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1447

This gene is a member of the following regulons

Gene
Coordinates
3,959,841 → 3,960,173
The protein
Protein family
[category|SW.1.2.2|PTS] permease, lactose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIA domain] type-3 (aa 3-101) (according to UniProt)
Structure
[PDB|3K1S] (IIA(Cel) from ''B. anthracis'', 42% identity)
Paralogous protein(s)
[protein|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]
description
[Pubmed|8990303]
regulation
carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8990303]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8990303], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]: activation, [Pubmed|8990303], in [regulon|protein:E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8990303], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]→[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]

2021-08-20 20:01:57

ghost

3

71a5a6a29188848adbfdb06b462667b975c2c7f8

DF3BDC652C79EB094E8D2D2CE50175B714C16E84

Biological materials
Mutant
BKE38570 (Δ[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCACGCGATTCACTTCCT,  downstream forward: _UP4_ACCGAGCAAAGGGGAGCAAG
BKK38570 (Δ[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCACGCGATTCACTTCCT,  downstream forward: _UP4_ACCGAGCAAAGGGGAGCAAG
References
19087206,8990303,16872404,10438772,10627040,8990303,27766092

E8B6C8E722BEE866878CDD816B7828C132F94FCD

Page visits: 1761

Time of last update: 2021-09-04 13:52:22

Author of last update: Melvin.boenninger