SubtiWiki SubtiWiki
lutP
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

lutP
168

lactate permease

locus
BSU_34190
Molecular weight
59.59 kDa
pI
9.48
Protein length
Gene length
function
lactate uptake
product
lactate permease
essential
no
synonyms
lutP, yvfH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1620

This gene is a member of the following regulons

Gene
Coordinates
3,510,780 → 3,512,471
Phenotypes of a mutant
poor growth with lactate as single carbon source [Pubmed|19201793]
The protein
Catalyzed reaction/ biological activity
lactate uptake [Pubmed|19201793]
Protein family
lactate permease family (with [protein|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP], according to UniProt)
Paralogous protein(s)
[protein|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]
[wiki|Localization]
membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]
description
[Pubmed|22383849]
regulation
expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
regulatory mechanism
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]) [Pubmed|16091051], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
[protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]: repression, in [regulon|protein:E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25031425], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]

2021-07-06 12:32:58

ghost

1

4d0a139f9c188bf8fb1d1ab5397a4e19d54a602b

A3F48CABDA805CB9E58EED1FC0BD3CFC9B204033

Biological materials
Mutant
MGNA-A489 (yvfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/489 NBRP B. subtilis, Japan]
BKE34190 (Δ[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCAAACCCCTCCTTGA,  downstream forward: _UP4_TAAAAAAATCCTCCCGTCTA
BKK34190 (Δ[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCAAACCCCTCCTTGA,  downstream forward: _UP4_TAAAAAAATCCTCCCGTCTA
labs
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
References
19201793,18763711,16091051,25031425,26582911

E607B0D57398BCCF64CF3CE2110E632B0C3A109E

Page visits: 2008

Time of last update: 2021-09-18 21:53:26

Author of last update: Melvin.boenninger