SubtiWiki SubtiWiki
yqfD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqfD
168

[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]-dependent sporulation gene, similar to UDP-glucose 4-epimerase

locus
BSU_25350
Molecular weight
45.57 kDa
pI
10
Protein length
Gene length
function
sporulation
product
unknown
essential
no
synonyms
yqfD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5872

This gene is a member of the following regulons

Gene
Coordinates
2,615,452 → 2,616,648
Phenotypes of a mutant
defect in sporulation [Pubmed|14523133]; some reduction in [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG] activity and production of small spores [Pubmed|26735940]
The protein
[wiki|Localization]
polar (Septum) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|41CC88CC3AE4FDDA909CCEF2DED16B554341D81E|yqfC]-[gene|E5F5528DA775DE3EE2DD1EC931CDC7E3781E018C|yqfD]
description
[Pubmed|12662922]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE], [wiki|SpoIIID]) [Pubmed|12662922,15383836]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [Pubmed|15383836], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|41CC88CC3AE4FDDA909CCEF2DED16B554341D81E|yqfC]→[gene|E5F5528DA775DE3EE2DD1EC931CDC7E3781E018C|yqfD]

2021-08-23 01:41:25

ghost

1

22f044c4de4534bef4627a202ed2c731ae4d5e74

BD9A38C6B28144809C94F334DCAA929E51EDC172

Biological materials
Mutant
MGNA-C444 (yqfD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2442 NBRP B. subtilis, Japan]
BKE25350 (Δ[gene|E5F5528DA775DE3EE2DD1EC931CDC7E3781E018C|yqfD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCACAACATTTCCCCCTC,  downstream forward: _UP4_CCTATTGTCAGGGAGACTGA
BKK25350 (Δ[gene|E5F5528DA775DE3EE2DD1EC931CDC7E3781E018C|yqfD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCACAACATTTCCCCCTC,  downstream forward: _UP4_CCTATTGTCAGGGAGACTGA
References
14523133,16479537,12662922,15383836,26735940

E5F5528DA775DE3EE2DD1EC931CDC7E3781E018C

Page visits: 1572

Time of last update: 2021-09-18 21:27:04

Author of last update: Jstuelk