SubtiWiki SubtiWiki
sivA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sivA
168

inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] autophosphorylation, and subsequently of entry into [wiki|sporulation]

locus
BSU_37800
Molecular weight
16.55 kDa
pI
7.18
Protein length
Gene length
function
control of entry into [wiki|sporulation] via the [wiki|phosphorelay]
product
inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] autophosphorylation
essential
no
synonyms
sivA, yweA, ipa-74d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,882,191 → 3,882,655
Phenotypes of a mutant
the'' [gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA] [gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]'' double mutant exhibits a more severe loss of repellency of the biofilm surface as compared to the ''[gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]'' mutant [Pubmed|22571672]
The protein
Catalyzed reaction/ biological activity
inhibits [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] autophophorylation [Pubmed|23335417]
Protein family
BslA/BslB family (with [protein|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA], according to UniProt)
Structure
[PDB|5MKD]
Paralogous protein(s)
[protein|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]
[wiki|Localization]
membrane (according to Swiss-Prot)
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA]
description
[Pubmed|12823818]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA]

2020-11-06 12:56:32

ghost

0

9e16e1df2569910a01de4de968987dc38f86269e

E174DF46E7B44987A595F4854342C0701B526E5D

Biological materials
Mutant
MGNA-B238 (yweA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1237 NBRP B. subtilis, Japan]
BKE37800 (Δ[gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACATTTCCCCCTAATT,  downstream forward: _UP4_TAATCGATAGATTTGTAGTC
BKK37800 (Δ[gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACATTTCCCCCTAATT,  downstream forward: _UP4_TAATCGATAGATTTGTAGTC
References
18957862,12823818,22571672,23335417,20817675,28698374,28751732

E5E2994D96FCECEE75E15136A08308C7B6C1C183

Page visits: 1046

Time of last update: 2021-09-18 22:02:15

Author of last update: Melvin.boenninger