SubtiWiki SubtiWiki
yjbL
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yjbL
168

unknown

locus
BSU_11590
Molecular weight
13.92 kDa
pI
4.32
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yjbL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,236,609 → 1,236,977
The protein
Protein family
UPF0738 family (single member, according to UniProt)
Expression and Regulation
Operons
genes
[gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]-[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]-[gene|2A2640A0501ECEA44A3C0C4842FAC053FB422A1F|nadF]-[gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]
description
[Pubmed|18067544]
regulation
expressed during exponential growth
Open in new tab

[gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]→[gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]

2021-07-01 04:09:46

Jstuelk

2

c5edd61e714281007d4d9ec99a1efa0cfef63f09

83E46551CBC32AB07130281546FE3D422612C2C3

additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
Mutant
MGNA-B158 (yjbL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1157 NBRP B. subtilis, Japan]
BKE11590 (Δ[gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGCTCTCCTTTTTTA,  downstream forward: _UP4_TAGAAACTGGTTCGGAATTG
BKK11590 (Δ[gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGCTCTCCTTTTTTA,  downstream forward: _UP4_TAGAAACTGGTTCGGAATTG
References
18067544,26883633

E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728

Page visits: 994

Time of last update: 2021-09-01 14:50:14

Author of last update: Melvin.boenninger