SubtiWiki SubtiWiki
tatAD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

tatAD
168

component of the [protein|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]-[protein|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD] twin-arginine translocase

locus
BSU_02630
Molecular weight
7.37 kDa
pI
9.69
Protein length
Gene length
function
TAT [wiki|protein secretion]
product
component of the twin-arginine translocation pathway
essential
no
synonyms
tatAD, yczB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1826

This gene is a member of the following regulons

Gene
Coordinates
285,775 → 285,987
The protein
Catalyzed reaction/ biological activity
translocation of [protein|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD] [Pubmed|19395490]
Protein family
TatA/E family (with [protein|8987552EFDF673776741405F7F5FE004556484CA|tatAC] and [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY], according to UniProt)
Structure
[PDB|2L16] [Pubmed|20726548]
Paralogous protein(s)
[protein|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY], [protein|8987552EFDF673776741405F7F5FE004556484CA|tatAC]
[wiki|Localization]
membrane (according to Swiss-Prot),  forms foci at the division sites and cell poles, localization requires interaction with [protein|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD] or [protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY] [Pubmed|19395490]
Expression and Regulation
Operons
genes
[gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]-[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]-[gene|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD]
description
[Pubmed|22383849]
regulation
expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|10094677]
regulatory mechanism
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|10094677,11007775], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10094677], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
expression of the operon depends on functional [protein|search|HemAT] and [protein|search|CsbC] [PubMed|23180473]
Open in new tab

[gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]→[gene|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD]

2021-10-22 16:20:34

ghost

10

c015e40a74e49c2ee0f16243375748d773825c85

B05615D1A6B638EF19AF5F2CDAAA7BE517BF1E14

Biological materials
Mutant
BKE02630 (Δ[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTTGAAAACATAATTTCCA,  downstream forward: _UP4_TGAATGCTGATGAGGCAGAC
BKK02630 (Δ[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTTGAAAACATAATTTCCA,  downstream forward: _UP4_TGAATGCTGATGAGGCAGAC
labs
[wiki|Jan Maarten van Dijl], University of Groningen, The Netherlands, [https://www.rug.nl/staff/j.m.van.dijl/ Homepage]
References
Reviews
22683878,24140208,25975269,25494301,27121927,31401776
Original Publications
12867413,15554971,20726548,11007775,19395490,21479178,21479530,22383849,10094677,23180473,23567937,20977272,27984091

E4395255CD43ACB611E0BA872182DF801662C366

Page visits: 1728

Time of last update: 2021-12-02 09:16:36

Author of last update: Jstuelk