SubtiWiki SubtiWiki
tatAD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tatAD
168

component of the [protein|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]-[protein|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD] twin-arginine translocase

locus
BSU_02630
Molecular weight
7.37 kDa
pI
9.69
Protein length
Gene length
function
TAT [wiki|protein secretion]
product
component of the twin-arginine translocation pathway
essential
no
synonyms
tatAD, yczB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1826

This gene is a member of the following regulons

Gene
Coordinates
285,775 → 285,987
The protein
Catalyzed reaction/ biological activity
translocation of [protein|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD] [Pubmed|19395490]
Protein family
TatA/E family (with [protein|8987552EFDF673776741405F7F5FE004556484CA|tatAC] and [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY], according to UniProt)
Structure
[PDB|2L16] [Pubmed|20726548]
Paralogous protein(s)
[protein|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY], [protein|8987552EFDF673776741405F7F5FE004556484CA|tatAC]
[wiki|Localization]
membrane (according to Swiss-Prot),  forms foci at the division sites and cell poles, localization requires interaction with [protein|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD] or [protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY] [Pubmed|19395490]
Expression and Regulation
Operons
genes
[gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]-[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]-[gene|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD]
description
[Pubmed|22383849]
regulation
expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|10094677]
regulatory mechanism
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|10094677,11007775], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10094677], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
expression of the operon depends on functional [protein|search|HemAT] and [protein|search|CsbC] [PubMed|23180473]
Open in new tab

[gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]→[gene|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD]

2021-09-14 16:20:41

ghost

5

c015e40a74e49c2ee0f16243375748d773825c85

B05615D1A6B638EF19AF5F2CDAAA7BE517BF1E14

Biological materials
Mutant
BKE02630 (Δ[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTTGAAAACATAATTTCCA,  downstream forward: _UP4_TGAATGCTGATGAGGCAGAC
BKK02630 (Δ[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTTTGAAAACATAATTTCCA,  downstream forward: _UP4_TGAATGCTGATGAGGCAGAC
labs
[wiki|Jan Maarten van Dijl], University of Groningen, The Netherlands, [https://www.rug.nl/staff/j.m.van.dijl/ Homepage]
References
Reviews
22683878,24140208,25975269,25494301,27121927,31401776
Original Publications
12867413,15554971,20726548,11007775,19395490,21479178,21479530,22383849,10094677,23180473,23567937,20977272,27984091

E4395255CD43ACB611E0BA872182DF801662C366

Page visits: 1707

Time of last update: 2021-09-14 17:55:10

Author of last update: Jstuelk