SubtiWiki SubtiWiki
ydaT

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ydaT
168

general stress protein, survival of ethanol stress and low temperatures

locus
BSU_04380
Molecular weight
16.42 kDa
pI
5.97
Protein length
Gene length
function
survival of ethanol stress and low temperatures
product
unknown
essential
no
ec
null
synonyms
ydaT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4876

This gene is a member of the following regulons

Gene
Coordinates
492,989 → 493,441
Expression and Regulation
Operons
genes
[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]-[gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]
description
[Pubmed|10482513]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|10482513], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]→[gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]

2021-10-04 15:59:58

ghost

2

8f6a8fdcac7e8725a126c926fdc234fc5a1d1bfc

BC3B508E35D6FCBE443A28317A140285F3F65320

Biological materials
Mutant
MGNA-C091 (ydaT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2089 NBRP B. subtilis, Japan]
BKE04380 (Δ[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTATCACTCCTTTTC,  downstream forward: _UP4_TAAAGGAATATGCTTTCAAG
BKK04380 (Δ[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTATCACTCCTTTTC,  downstream forward: _UP4_TAAAGGAATATGCTTTCAAG
References
15805528,10482513,23033921

E30C92E8D0CC56F7406B87B7EA25B7C41086DD73

Page visits: 773

Time of last update: 2021-10-12 11:11:27

Author of last update: Bzhu