SubtiWiki SubtiWiki
ftsX
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ftsX
168

[wiki|ABC transporter] (membrane protein) ([protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]), required for [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] activity (cell elongation) and for proper activation of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A] and initiation of [wiki|sporulation]

locus
BSU_35250
Molecular weight
32.95 kDa
pI
10.02
Protein length
Gene length
function
control of cell wall synthesis
product
[wiki|ABC transporter] (membrane protein)
essential
no
synonyms
ftsX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2177

This gene is a member of the following regulons

Gene
Coordinates
3,623,938 → 3,624,828
Phenotypes of a mutant
a ''[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]'' mutation is synthetically lethal with a ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]
shorter, fatter cells, this can be rescued by addition of Mg(2+) [Pubmed|23869552,23855774]
reduced growth rate, especially at low Mg(2+) concentrations [Pubmed|23869552]
loss of genetic competence [pubmed|29553055]
The protein
Catalyzed reaction/ biological activity
necessary for the autolysin activity of [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] [Pubmed|23855774]
Protein family
[wiki|ABC-4 integral membrane protein family] (according to UniProt)
[wiki|Localization]
cell membrane [Pubmed|23869552]
Expression and Regulation
Operons
genes
[gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]-[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]
description
(according to [http://dbtbs.hgc.jp/COG/prom/ftsEX.html DBTBS]) null
regulation
repressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
Open in new tab

[gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]→[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]

2021-08-18 03:18:56

ghost

1

2cc5c6f6d5937ee06ba05b9f32e1806d70a64558

0160C162B03C88639486948C622D41CB46D2FE11

Biological materials
Mutant
GP3198 ([gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]::''spc''), available in [wiki|Jörg Stülke]'s lab
BKE35250 (Δ[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCACGCAAGTGGCGCCCGA,  downstream forward: _UP4_TAAAGTGAAAAAGCCGTTCC
BKK35250 (Δ[gene|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|ftsX]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCACGCAAGTGGCGCCCGA,  downstream forward: _UP4_TAAAGTGAAAAAGCCGTTCC
References
Reviews
33709487
Original Publications
10092453,18573177,23651456,14651647,18763711,23855774,23869552,29553055,31437162,33450852

E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490

Page visits: 2047

Time of last update: 2021-09-10 18:50:30

Author of last update: Jstuelk