SubtiWiki SubtiWiki
ybfQ
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybfQ
168

unknown

locus
BSU_02330
Molecular weight
37.11 kDa
pI
4.91
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ybfQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1054

This gene is a member of the following regulons

Gene
Coordinates
252,514 → 253,482
The protein
Protein family
UPF0176 family (single member, according to UniProt)
[wiki|Domains]
[wiki|Rhodanese domain] (aa 125-219) (according to UniProt)
Structure
[PDB|4F67] (from Legionella pneumophila, corresponds to aa 10 ... 234, 41% identity)
Expression and Regulation
Operons
genes
[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]-[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]
description
[Pubmed|12207695]
regulation
repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]) [Pubmed|18840696]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696,20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11866510,12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab

[gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]→[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]

2021-09-05 04:05:07

Jstuelk

3

50a945625df291fbb5df9027fa7857ca92a76e0e

38EAB2C0FEF8D67A055D05FB47AFE694C464191E

Biological materials
Mutant
MGNA-B936 (ybfQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1935 NBRP B. subtilis, Japan]
BKE02330 (Δ[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTAAACACCCTGTT,  downstream forward: _UP4_TAAAAAAAGAACACCTCGTA
BKK02330 (Δ[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTAAACACCCTGTT,  downstream forward: _UP4_TAAAAAAAGAACACCTCGTA
References
12207695

E06787B6AAD11070751938822F75359CE6EF299C

Page visits: 947

Time of last update: 2021-09-18 23:46:05

Author of last update: Melvin.boenninger