SubtiWiki SubtiWiki
sodF
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sodF
168

superoxide dismutase

locus
BSU_19330
Molecular weight
33.32 kDa
pI
6.17
Protein length
Gene length
function
detoxification of oxygen radicals
product
superoxide dismutase
essential
no
synonyms
sodF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0605

This gene is a member of the following regulons

Gene
Coordinates
2,104,056 → 2,104,901
The protein
Catalyzed reaction/ biological activity
2 superoxide + 2 H+ --> O2 + H2O2 (according to UniProt)
Protein family
iron/manganese superoxide dismutase family (with [protein|6153A07B961017052E1072944B59F510D80CEC0F|sodA], according to UniProt)
[wiki|Cofactors]
contains an iron-sulfur cluster
Structure
[PDB|3EVK] (aa 80 ... 280, from Pyrobaculum aerophilum, 54% identity)
Paralogous protein(s)
[protein|6153A07B961017052E1072944B59F510D80CEC0F|sodA]
Expression and Regulation
Operons
genes
[gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]-[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]
description
[Pubmed|18436644]
regulation
expressed during sporulation in the mother cell [Pubmed|18436644]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,18436644], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]→[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]

2021-08-16 03:38:16

ghost

2

6fa4c70048aebc58f3cffd6e248603b84d1b4262

DF3BA7099188F609C6B2A0A09963B06207F9360B

Biological materials
Mutant
BKE19330 (Δ[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTGAACATCTCCGCTTGAT,  downstream forward: _UP4_TAAAAAAAGCCCCCTTTCCT
BKK19330 (Δ[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTGAACATCTCCGCTTGAT,  downstream forward: _UP4_TAAAAAAAGCCCCCTTTCCT
References
18436644

E0645DD4A7A871457300139A7E5986EF11C07387

Page visits: 1650

Time of last update: 2021-09-16 12:06:10

Author of last update: Melvin.boenninger