SubtiWiki SubtiWiki
pssA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pssA
168

phosphatidylserine synthase

locus
BSU_02270
Molecular weight
19.47 kDa
pI
7.88
Protein length
Gene length
function
biosynthesis of phospholipids
product
phosphatidylserine synthase
essential
no
ec
2.7.8.8
synonyms
pssA, pss

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1183

This gene is a member of the following regulons

Gene
Coordinates
247,744 → 248,277
The protein
Catalyzed reaction/ biological activity
CDP-1,2-diacyl-sn-glycerol + L-serine --> 1,2-diacyl-sn-glycero-3-phospho-L-serine + CMP + H+ (according to UniProt)
Protein family
CDP-alcohol phosphatidyltransferase class-I family (with [protein|2DB0071F2B747A7D5607C7A1B51564C25DC0BA8D|pgsA], according to UniProt)
[wiki|Localization]
cell membrane at the septum [Pubmed|15743965]
Expression and Regulation
Operons
genes
[gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]-[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]-[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|ybfM]-[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]
description
[Pubmed|22383849,14762009]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|14762009], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|14762009], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]→[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]

2021-08-31 10:28:47

Jstuelk

7

9c5c2fcf642de63f240b8ac199efc5b5939a836b

2A09CF2D25D4B824D045D3A292B8FC9B5A167361

Biological materials
Mutant
BKE02270 (Δ[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGTGTAACCAAACCTCC,  downstream forward: _UP4_GCAGAAAACCTGGAGTCTGG
BKK02270 (Δ[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGTGTAACCAAACCTCC,  downstream forward: _UP4_GCAGAAAACCTGGAGTCTGG
References
Reviews
9370336
Original Publications
14762009,18820022,9422599,8829529,15743965,28376879

DE49797486CEC172F912D26A6BF2223190BF5DAD

Page visits: 1806

Time of last update: 2021-09-19 03:39:46

Author of last update: Melvin.boenninger