SubtiWiki SubtiWiki
ylbK

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ylbK
168

similar to patatin-like phospholipase

locus
BSU_15040
Molecular weight
28.11 kDa
pI
9.16
Protein length
Gene length
function
unknown
product
putative phospholipase
essential
no
synonyms
ylbK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1752

This gene is a member of the following regulons

Gene
Coordinates
1,571,981 → 1,572,763
The protein
Protein family
NTE family (single member, according to UniProt)
[wiki|Domains]
PNPLA domain (aa 8-166) (according to UniProt)
Structure
[PDB|5FYA] (from Pseudomonas aeruginosa, 35% identity) [pubmed|27012424]
Expression and Regulation
Operons
genes
[gene|DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC|ylbK]-[gene|1A5C1BDE844AA56B90C0E4A02D74978676487E99|ddcP]
description
[pubmed|22383849]
Open in new tab

[gene|DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC|ylbK]→[gene|1A5C1BDE844AA56B90C0E4A02D74978676487E99|ddcP]

2021-10-16 12:41:29

Jstuelk

4

d30f68bf0d60540ed31de8c89b714d845d30a9bd

F6314ED871A06F8C19B92CB00C615485C7553236

Biological materials
Mutant
MGNA-B247 (ylbK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1246 NBRP B. subtilis, Japan]
BKE15040 (Δ[gene|DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC|ylbK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGCGTTAACCTCCTGCC,  downstream forward: _UP4_ATAGAGAATTGGGAGGGCTC
BKK15040 (Δ[gene|DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC|ylbK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGCGTTAACCTCCTGCC,  downstream forward: _UP4_ATAGAGAATTGGGAGGGCTC
References
20525796,27012424

DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC

Page visits: 721

Time of last update: 2021-10-09 19:52:17

Author of last update: Melvin.boenninger