SubtiWiki SubtiWiki
ydaE
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydaE
168

lyxose isomerase, general stress protein, survival of ethanol stress and low temperatures

locus
BSU_04200
Molecular weight
19.11 kDa
pI
4.88
Protein length
Gene length
function
survival of ethanol stress and low temperatures
product
lyxose isomerase
essential
no
ec
null
synonyms
ydaE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3822

This gene is a member of the following regulons

Gene
Coordinates
472,585 → 473,088
The protein
Catalyzed reaction/ biological activity
D-lyxose --> D-xylulose (according to UniProt)
Protein family
D-lyxose ketol-isomerase family (single member, according to UniProt)
Structure
[PDB|2Y0O] [Pubmed|21520290]
Expression and Regulation
Operons
genes
[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]-[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]
description
[Pubmed|22383849]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [pubmed|15805528,10220166], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]→[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]

2021-09-07 11:00:42

Jstuelk

4

4fb2a110a5d336e59c462730f404e23690d89eac

7BAF2B4B190B99035F090F954FC6468528A7BBF8

genes
[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]-[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]-[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
description
[Pubmed|10220166]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528,10220166], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]→[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]

2021-09-12 12:56:32

ghost

5

0f01f3d4a72c13fc2bd8814fcb16a6972198e29f

A2B50F578CB3D7FDB3773EE82697C8F07A97C986

Biological materials
Mutant
MGNA-C087 (ydaE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2085 NBRP B. subtilis, Japan]
BKE04200 (Δ[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATGCCCATATGTCTCACTC,  downstream forward: _UP4_TAAGGATGGGCTTAACAGCC
BKK04200 (Δ[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GATGCCCATATGTCTCACTC,  downstream forward: _UP4_TAAGGATGGGCTTAACAGCC
References
10220166,15805528,23033921,21520290

DDE975DA2E13759B0DB8B6D219760C2E2C6032FB

Page visits: 1239

Time of last update: 2021-08-19 20:51:44

Author of last update: Melvin.boenninger