SubtiWiki SubtiWiki
yqzH
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqzH
168

unknown

locus
BSU_23720
Molecular weight
7.82 kDa
pI
4.63
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yqzH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,465,966 → 2,466,172
The protein
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|DDBD74D8F633D65F0F67D3C8B92DC3BC2E9EDB73|yqzH]
description
[Pubmed|22383849]
regulation
induced upon DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]) [Pubmed|16267290]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
Open in new tab

[gene|DDBD74D8F633D65F0F67D3C8B92DC3BC2E9EDB73|yqzH]

2020-11-06 12:56:32

Jstuelk

0

c473ee214a43e0495e244e5b4307350c3800f6cc

30FD2B1E6EC7E41378F7DA3EEED462BA7BA5274D

Biological materials
Mutant
BKE23720 (Δ[gene|DDBD74D8F633D65F0F67D3C8B92DC3BC2E9EDB73|yqzH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGACTCTCCTATCCT,  downstream forward: _UP4_TAAACGCATGACTGTCAGTT
BKK23720 (Δ[gene|DDBD74D8F633D65F0F67D3C8B92DC3BC2E9EDB73|yqzH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGACTCTCCTATCCT,  downstream forward: _UP4_TAAACGCATGACTGTCAGTT
References
16267290

DDBD74D8F633D65F0F67D3C8B92DC3BC2E9EDB73

Page visits: 1156

Time of last update: 2021-08-17 20:06:03

Author of last update: Jstuelk