SubtiWiki SubtiWiki
xtmA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

xtmA
168

PBSX terminase (small subunit)

locus
BSU_12570
Molecular weight
30.09 kDa
pI
9.54
Protein length
Gene length
function
phage DNA replication
product
PBSX terminase (small subunit)
essential
no
synonyms
xtmA, ykxF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3728

This gene is a member of the following regulons

Gene
Coordinates
1,325,096 → 1,325,893
Expression and Regulation
Operons
genes
[gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]-[gene|277F51EB4FE2BAB0FD1808EDE25705E10833AD0A|xtmB]-[gene|E77DD93E3CDCA9B81106E6AB0F18513360AAE9DB|xkdE]-[gene|6542BE447872C1A16C056DA21BD7A23C65F5C543|xkdF]-[gene|38173C76C27A7178CEE66E3642533EB34828C2CB|xkdG]-[gene|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|xkdH]-[gene|5ACCC439AD8849355094F8C5FC6EF29A9077EF58|xkdI]-[gene|6DF19E4546509687CA194F6B44EEB723C9467B9C|xkdJ]-[gene|31B1832E5EAD957EE6A5C7CB0C117EC0F26AA8AB|xkdK]-[gene|683D350D98AC0D27951145AD87830B89C0B4F393|xkdM]-[gene|0BF8AD1ACD0BBA6913636081B41E6D04D16D1BA2|xkdN]-[gene|156A8B699B32B268EBA1A0A1620C95D0DF630A4E|xkzB]-[gene|CD97483876F4FCCE451AD4F2A8AFD6F560074769|xkdO]-[gene|ED35852FAAD386CFB43F8D3DDEF28F7B05EC8B43|xkdP]-[gene|D5FDCC792D0E6B8D35BCDDC0D7B76025ACC900FF|xkdQ]-[gene|AF9706F2EBF056A404B5D7640D78D1E833805225|xkdR]-[gene|C222F247C225FD6DEBB103DFB169AEF87DFC0C0D|xkdS]-[gene|1234C9BC164FB47E003009E943124982260221C0|xkdT]-[gene|BDE032590D5F3504CDB4D6BD545153D681B65ADD|xkdU]-[gene|3BCF7587145CFEDEA2F36512ABF62D6B6A2886C5|xkzA]-[gene|9FAAA2E63B161862396C47CE5D1EA9191847FDAD|xkdV]-[gene|1F152F97AD20DABAC1D83EDC2177F46EAECC562C|xkdW]-[gene|787561F433911D090F801AD493F688895498542F|xkdX]-[gene|27BB6659541BA5368DEDB19EADCD372CE41244F5|xepA]-[gene|630FC0D9BDD243D6BF94DBDE506EC2A9CB0AAFE6|xhlA]-[gene|360D866E939DDB822AFAC589D563B191A88695CD|xhlB]-[gene|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA]
description
[Pubmed|22383849,2110147]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
sigma factors
[protein|458406A4E6824C24493CFC19718F10720AA3B453|xpf]: sigma factor, [Pubmed|8083174], in [regulon|protein:458406A4E6824C24493CFC19718F10720AA3B453|xpf regulon]
Open in new tab

[gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]→[gene|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA]

2021-09-05 09:04:25

Jstuelk

7

cf834a1eded0c80a87b885b56423c31a910431c3

B52CA80EBED69B6B9017B7E04DFFD42F17910C15

Biological materials
Mutant
BKE12570 (Δ[gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTACTGCATCACCGCC,  downstream forward: _UP4_ATCAAACGAAAAGAGCGCAA
BKK12570 (Δ[gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTACTGCATCACCGCC,  downstream forward: _UP4_ATCAAACGAAAAGAGCGCAA
References
2110147,8083174

DD4F52FE386EF75009ECF594ED4E2D1593220E4F

Page visits: 1221

Time of last update: 2021-09-18 04:29:18

Author of last update: Bzhu