SubtiWiki SubtiWiki
mtbP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mtbP
168

DNA (cytosine-5-)-methyltransferase

locus
BSU_20250
Molecular weight
50.35 kDa
pI
7.8
Protein length
Gene length
function
DNA modification
product
DNA (cytosine-5-)-methyltransferase
essential
no
ec
2.1.1.37
synonyms
mtbP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0270

This gene is a member of the following regulons

Gene
Coordinates
2,171,401 → 2,172,732
The protein
Catalyzed reaction/ biological activity
2'-deoxycytidine in DNA + S-adenosyl-L-methionine --> 5-methyl-2'-deoxycytidine in DNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
[wiki|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
[wiki|Domains]
SAM-dependent MTase C5-type domain (aa 4-440) (according to UniProt)
Structure
[PDB|1MHT] (from Haemophilus haemolyticus, 28% identity) [pubmed|8293469]
Biological materials
Mutant
BKE20250 (Δ[gene|DAE0C61FD9902AD3092A779105B4A0E656069266|mtbP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACAAACAACCTCCATATA,  downstream forward: _UP4_TAAAATTTGTCTTTTAAACA
BKK20250 (Δ[gene|DAE0C61FD9902AD3092A779105B4A0E656069266|mtbP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20250 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACAAACAACCTCCATATA,  downstream forward: _UP4_TAAAATTTGTCTTTTAAACA
References
Research papers
8293469, 6302313, 6269059, 3087819

DAE0C61FD9902AD3092A779105B4A0E656069266

Page visits: 941

Time of last update: 2021-04-10 12:28:03

Author of last update: Rhertel