SubtiWiki SubtiWiki
katX
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

katX
168

catalase, general stress protein

locus
BSU_38630
Molecular weight
62.19 kDa
pI
5.34
Protein length
Gene length
function
detoxification (degradation) of hydrogen peroxide
product
catalase (major catalase in spores)
essential
no
synonyms
katX, yxlI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0753

This gene is a member of the following regulons

Gene
Coordinates
3,964,997 → 3,966,640
The protein
Catalyzed reaction/ biological activity
2 H2O2 --> 2 H2O + O2 (according to UniProt)
Protein family
[wiki|catalase family] (according to UniProt)
Structure
[PDB|4CAB] (from Deinococcus radiodurans, 69% identity) [pubmed|24975828]
Paralogous protein(s)
[protein|B0A1AB6E920E6CBEE45115297599AF9A80972E38|katA], [protein|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|katE]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|katX]
description
[Pubmed|10503549]
regulation
expressed early during sporulation in the forespore ([protein|search|SigF], [protein|search|RsfA]) [Pubmed|16497325,15699190,10629188]
regulatory mechanism
[protein|7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA]: activation, [Pubmed|10629188], in [regulon|protein:7C0458DB0E3E3AC952FB9DDBC4AD220A3A456359|rsfA regulon]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|10503549,15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|10503549,16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab

[gene|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|katX]

2021-05-01 01:13:55

ghost

2

29e21c52d079ea0b9958ad7b7722ceea51dfd8ad

833F49D36D71B1A83F8D8C883960CE680C1F02D4

Biological materials
Mutant
MGNA-B755 (katX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1754 NBRP B. subtilis, Japan]
BKE38630 (Δ[gene|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|katX]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTGGCCCTCCTTTT,  downstream forward: _UP4_TAACAACAGCGAACAGGGCT
BKK38630 (Δ[gene|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|katX]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTGGCCCTCCTTTT,  downstream forward: _UP4_TAACAACAGCGAACAGGGCT
References
9393707,10503549,16497325,9555886,15805528,10629188,24975828

DA5EB526EE8AF41BE9B837F2C276432BC4183AA1

Page visits: 1786

Time of last update: 2021-09-16 08:16:54

Author of last update: Melvin.boenninger