SubtiWiki SubtiWiki
spoIIB
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoIIB
168

spatial and temporal regulation of the dissolution of septal peptidoglycan during engulfment

locus
BSU_28060
Molecular weight
35.77 kDa
pI
4.8
Protein length
Gene length
function
spore morphogenesis
product
facilitator of septal dissolution
essential
no
ec
null
synonyms
spoIIB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5816

This gene is a member of the following regulons

Gene
Coordinates
2,863,294 → 2,864,292
The protein
[wiki|Domains]
SPOR domain (aa 175-250) (according to UniProt)
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|D98D61CA651AAA415386B1B2B41562E5CF77DEF1|spoIIB]
description
[Pubmed|12107147]
regulation
expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
sigma factors
[protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV]: sigma factor, in [regulon|protein:D04629D798E458AD538809BB2B150B7FA81D2C7E|sigV regulon]
Open in new tab

[gene|D98D61CA651AAA415386B1B2B41562E5CF77DEF1|spoIIB]

2021-07-16 01:09:09

ghost

1

613aca2467317449239594c4b7c3f89c11d62127

431135D9B1477154B2CFD0226BD0E3FFFBECC13F

Biological materials
Mutant
BKE28060 (Δ[gene|D98D61CA651AAA415386B1B2B41562E5CF77DEF1|spoIIB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTCCGCTTCCTCCCTTC,  downstream forward: _UP4_TAAGAGATAGTGCCCTGAGC
BKK28060 (Δ[gene|D98D61CA651AAA415386B1B2B41562E5CF77DEF1|spoIIB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTCCGCTTCCTCCCTTC,  downstream forward: _UP4_TAAGAGATAGTGCCCTGAGC
References
17376078,8419299,7559352,12107147,33651833

D98D61CA651AAA415386B1B2B41562E5CF77DEF1

Page visits: 1227

Time of last update: 2021-09-09 16:34:57

Author of last update: Jstuelk