SubtiWiki SubtiWiki
yodS
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yodS
168

similar to butyrate-acetoacetate CoA-transferase

locus
BSU_19730
Molecular weight
24.26 kDa
pI
4.44
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yodS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1788

This gene is a member of the following regulons

Gene
Coordinates
2,143,660 → 2,144,349
The protein
Protein family
3-oxoacid CoA-transferase subunit A family (with [protein|A7E61C3D12BBDDD3EFD65B1EDBE280497D7B6CD0|scoA], according to UniProt)
Structure
[PDB|3CDK] (the [protein|A7E61C3D12BBDDD3EFD65B1EDBE280497D7B6CD0|scoA]-[protein|7F46EDA8F1EB8D9817C62D7D361FF32F9CD814AD|scoB] complex) (51% identity)
Paralogous protein(s)
[protein|A7E61C3D12BBDDD3EFD65B1EDBE280497D7B6CD0|scoA]
Expression and Regulation
Operons
genes
[gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]-[gene|D8A050BF150C6E5B910C24C0E023F0829EC95BAD|yodS]-[gene|138832210AC94B17E081F3D0AF9BCFE3BE63E601|yodR]-[gene|161ADC907D4902001C8751F51CFA762828C26110|yodQ]-[gene|39749B5EADC3C056BAF232E0B586C65B989F7F77|yodP]-[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]-[gene|A4A099EE3368891C2AD6C2D1DCBE7B238227417F|yokU]-[gene|0A33869E05CC9B49699555EA19D0905A55CA35B9|yozE]
description
[Pubmed|22383849,14523133]
regulation
expressed early during sporuation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]) [Pubmed|14523133]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|14523133], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]→[gene|0A33869E05CC9B49699555EA19D0905A55CA35B9|yozE]

2021-09-13 01:12:06

Jstuelk

4

44c21f8f9a51cb42563a9e5c6caad0babb60d90a

17328CC7373AFF7A88C018C39EBE54803F7E1157

Biological materials
Mutant
MGNA-B507 (yodS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1506 NBRP B. subtilis, Japan]
BKE19730 (Δ[gene|D8A050BF150C6E5B910C24C0E023F0829EC95BAD|yodS]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTTGAAATGGCGCCATTT,  downstream forward: _UP4_CGAAGCGAGGGAGTGAAGTG
BKK19730 (Δ[gene|D8A050BF150C6E5B910C24C0E023F0829EC95BAD|yodS]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19730 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTTGAAATGGCGCCATTT,  downstream forward: _UP4_CGAAGCGAGGGAGTGAAGTG
References
14523133

D8A050BF150C6E5B910C24C0E023F0829EC95BAD

Page visits: 798

Time of last update: 2021-08-30 06:09:14

Author of last update: Melvin.boenninger