SubtiWiki SubtiWiki
ybaC
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybaC
168

similar to proline iminopeptidase

locus
BSU_01140
Molecular weight
36.74 kDa
pI
9.65
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ybaC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0596

This gene is a member of the following regulons

Gene
Coordinates
134,171 → 135,127
The protein
Protein family
Peptidase S33 family (single member, according to UniProt)
Structure
[PDB|3WMR] (from Streptomyces halstedii, 25% identity) [pubmed|24530530]
Biological materials
Mutant
MGNA-B944 (ybaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1943 NBRP B. subtilis, Japan]
BKE01140 (Δ[gene|D74DCFAE414EEBBB79D200EC85905E76C51792F1|ybaC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAATATTAACCCCTCGA,  downstream forward: _UP4_TGATAGATCCTTGATAAATA
BKK01140 (Δ[gene|D74DCFAE414EEBBB79D200EC85905E76C51792F1|ybaC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01140 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAATATTAACCCCTCGA,  downstream forward: _UP4_TGATAGATCCTTGATAAATA
References
Research papers
24530530

D74DCFAE414EEBBB79D200EC85905E76C51792F1

Page visits: 846

Time of last update: 2021-09-16 20:05:09

Author of last update: Jstuelk