SubtiWiki SubtiWiki
yndJ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yndJ
168

unknown

locus
BSU_17800
Molecular weight
62.30 kDa
pI
9.85
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yndJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,912,953 → 1,914,593
The protein
[wiki|Localization]
membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|963F684823CC1EEACBE5454F37E9B8829EA1EA23|yndG]-[gene|B949DBB16B0476F4073D77BE9F60D03E302FBBC1|yndH]-[gene|D5FE7BD56C10CD05B90DB3EDA0622D1982B38F68|yndJ]-[gene|12F3F8846739480E5980EE01A761990AE24B26F7|yndK]
description
[Pubmed|22383849]
Open in new tab

[gene|963F684823CC1EEACBE5454F37E9B8829EA1EA23|yndG]→[gene|12F3F8846739480E5980EE01A761990AE24B26F7|yndK]

2021-08-19 20:51:34

Jstuelk

3

ac5e38136fd0c4d220c59950cc8647c62f8571c4

7F8662222EFFFBA87DE9F15870CEA381BA13240C

Biological materials
Mutant
MGNA-B110 (yndJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1109 NBRP B. subtilis, Japan]
BKE17800 (Δ[gene|D5FE7BD56C10CD05B90DB3EDA0622D1982B38F68|yndJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCACTGACTATGCCATTTC,  downstream forward: _UP4_TAACACAAAGAAGAAGCTTC
BKK17800 (Δ[gene|D5FE7BD56C10CD05B90DB3EDA0622D1982B38F68|yndJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGCACTGACTATGCCATTTC,  downstream forward: _UP4_TAACACAAAGAAGAAGCTTC

D5FE7BD56C10CD05B90DB3EDA0622D1982B38F68

Page visits: 878

Time of last update: 2021-10-05 17:49:11

Author of last update: Jstuelk