SubtiWiki SubtiWiki
pheA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

pheA
168

prephenate dehydratase

locus
BSU_27900
Molecular weight
31.75 kDa
pI
5.89
Protein length
Gene length
function
biosynthesis of phenylalanine
product
prephenate dehydratase
essential
no
ec
4.2.1.51
synonyms
pheA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0077

This gene is a member of the following regulons

Gene
Coordinates
2,851,283 → 2,852,140
The protein
Catalyzed reaction/ biological activity
H+ + prephenate --> 3-phenylpyruvate + CO2 + H2O (according to UniProt)
[wiki|Domains]
Prephenate dehydratase domain (aa 2-183) (according to UniProt)
[wiki|ACT domain] (aa 204-281) (according to UniProt)
Structure
[PDB|4LUB] (from ''Streptococcus mutans'', 42% identity)
Effectors of protein activity
subject to feedback inhibtion by phenylalanine [Pubmed|4956345]
Expression and Regulation
Operons
genes
[gene|29D91115BB3AC03538D618E54A5A57F92777EFF6|spo0B]-[gene|84E7D672DB40B114DC4D96A4D8834958B47401A7|obg]-[gene|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]-[gene|D4CCF6727AAC048792E59717E588C36EB617249D|pheA]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2537815], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
expression is repressed by binding of [wiki|RpoE] to the A-rich sequence in the -35 region of the promoter [Pubmed|27679485]
Open in new tab

[gene|29D91115BB3AC03538D618E54A5A57F92777EFF6|spo0B]→[gene|D4CCF6727AAC048792E59717E588C36EB617249D|pheA]

2021-10-11 00:58:52

ghost

8

22e8673d70be078a28f38f2ef0353054aac7a361

EFF1EF2402AB3F0071535ACBC9F9FB0A68987C02

Biological materials
Mutant
1A617 ( ''pheA''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A617&Search=1A617 BGSC]
BKE27900 (Δ[gene|D4CCF6727AAC048792E59717E588C36EB617249D|pheA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GACTTTCATGACGATTTTCT,  downstream forward: _UP4_TAAAAAAAGCCCACTAGAGG
BKK27900 (Δ[gene|D4CCF6727AAC048792E59717E588C36EB617249D|pheA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GACTTTCATGACGATTTTCT,  downstream forward: _UP4_TAAAAAAAGCCCACTAGAGG
References
19258532,2537815,4956345

D4CCF6727AAC048792E59717E588C36EB617249D

Page visits: 2832

Time of last update: 2021-10-14 23:12:15

Author of last update: Melvin.boenninger