SubtiWiki SubtiWiki
yerD
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yerD
168

general stress protein, similar to glutamate synthase (ferredoxin), required for protection against paraquat stress

locus
BSU_06590
Molecular weight
58.58 kDa
pI
7.35
Protein length
Gene length
function
protection against paraquat stress
product
unknown
essential
no
synonyms
yerD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0069

This gene is a member of the following regulons

Gene
Coordinates
716,780 → 718,357
The protein
Protein family
glutamate synthase family (with [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA] and [protein|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB], according to UniProt)
[wiki|Cofactors]
FMN or FAD [Pubmed|21635694]
Structure
[PDB|1EA0] (from Azospirillum brasilense, corresponds to aa 184 ... 495, 30% identity)
Paralogous protein(s)
[protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD]
description
[Pubmed|22383849]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD]

2021-08-14 00:58:02

ghost

3

8a7c5306a68e91da05898da41672c2a7ea73f79f

21A32946C8BFCE13E4005C8696FD6CF2A4CA674A

Biological materials
Mutant
MGNA-A925 (yerD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/925 NBRP B. subtilis, Japan]
GP1184 (tet) available in [wiki|Jörg Stülke]'s lab
BKE06590 (Δ[gene|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCAGCCTCCCTTTT,  downstream forward: _UP4_TAAAGAAACCGCCCTTGCCA
BKK06590 (Δ[gene|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCAGCCTCCCTTTT,  downstream forward: _UP4_TAAAGAAACCGCCCTTGCCA
Expression vectors
pBP32 (expression vector for ''E. coli'' BL21; N-terminal Strep-tag-YerD fusion protein, based on [wiki|pGP172]), available in [wiki|Fabian Commichau]'s lab
FLAG-tag construct
GP1187 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Fabian Commichau], Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
References
15805528,22383849,23033921,22582280

D1AF9DA2594D2E2A94DC207A870C8495954A7A17

Page visits: 1449

Time of last update: 2021-07-23 03:23:11

Author of last update: Jstuelk