SubtiWiki SubtiWiki
sspL
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sspL
168

small acid-soluble spore protein (minor SASP)

locus
BSU_22000
Molecular weight
4.56 kDa
pI
10.31
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (minor SASP)
essential
no
ec
null
synonyms
sspL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5858

This gene is a member of the following regulons

Gene
Coordinates
2,310,859 → 2,310,987
Expression and Regulation
Operons
genes
[gene|D105FCA5F5249A96CC35581D258F78AF82CFEA3B|sspL]
description
[Pubmed|10333516]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,10333516]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,10333516], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|D105FCA5F5249A96CC35581D258F78AF82CFEA3B|sspL]

2020-11-06 12:56:32

ghost

0

3cb01a24512029bb169ff46955254e5026ed6414

89A36D134519BD2234108EDF29BA74F97B14E481

Biological materials
Mutant
BKE22000 (Δ[gene|D105FCA5F5249A96CC35581D258F78AF82CFEA3B|sspL]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTAGTTCACCTCGCCA,  downstream forward: _UP4_AGCAATACAAAACGCTAGAG
BKK22000 (Δ[gene|D105FCA5F5249A96CC35581D258F78AF82CFEA3B|sspL]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTAGTTCACCTCGCCA,  downstream forward: _UP4_AGCAATACAAAACGCTAGAG
References
10333516

D105FCA5F5249A96CC35581D258F78AF82CFEA3B

Page visits: 872

Time of last update: 2021-08-15 18:37:34

Author of last update: Melvin.boenninger