SubtiWiki SubtiWiki
ycnJ
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycnJ
168

copper transporter

locus
BSU_03950
Molecular weight
59.64 kDa
pI
10.1
Protein length
Gene length
function
uptake of copper
product
copper transporter
essential
no
ec
null
synonyms
ycnJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2372

This gene is a member of the following regulons

Gene
Coordinates
446,801 → 448,426
Phenotypes of a mutant
growth-defective under copper-limiting conditions [Pubmed|19168619]
The protein
Catalyzed reaction/ biological activity
uptake of copper [Pubmed|19168619]
Protein family
N-terminal part: CopC family (single member, according to UniProt)
C-terminal part: CopD family (single member, according to UniProt)
[wiki|Localization]
cell membrane [Pubmed|19168619]
Expression and Regulation
Operons
genes
[gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]
description
[Pubmed|22904286,22383849]
regulation
induced by copper limitation ([protein|search|YcnK]) [Pubmed|22904286,19168619]
regulatory mechanism
[protein|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]: repression, [Pubmed|22904286,19168619], in [regulon|protein:98D807FBB847BF731B5C236557C8F70347279CE0|ycnK regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|15101989], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22904286], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]→[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]

2021-07-22 08:04:21

ghost

2

8c53a82ab33b564f7e085488581f68629ff467ca

7BEB015AF7C4D6403B44178463BB2A5EFEF7821A

Biological materials
Mutant
BKE03950 (Δ[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACTCAGACACCACCTT,  downstream forward: _UP4_AAGACCAATTAAGGAGTGTT
BKK03950 (Δ[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACTCAGACACCACCTT,  downstream forward: _UP4_AAGACCAATTAAGGAGTGTT
labs
[wiki|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
References
19168619,22904286,22383849

D0F553E661A35C69380ACB01D9A96FC6C5088470

Page visits: 1243

Time of last update: 2021-09-06 10:05:13

Author of last update: Melvin.boenninger