SubtiWiki SubtiWiki
ptpZ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ptpZ
168

phosphotyrosine protein phosphatase, antagonist to [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]

locus
BSU_36240
Molecular weight
28.81 kDa
pI
6.66
Protein length
Gene length
function
protein tyrosine dephosphorylation
product
phosphotyrosine protein phosphatase, antagonist to [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]
essential
no
ec
3.1.3.48
synonyms
ptpZ, ywqE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4464

This gene is a member of the following regulons

Gene
Coordinates
3,731,005 → 3,731,769
The protein
Catalyzed reaction/ biological activity
H2O + O-phospho-L-tyrosyl-[protein] --> L-tyrosyl-[protein] + phosphate (according to UniProt)
dephosphorylation of [protein|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|ugd], [protein|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|tuaD] and [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA] [Pubmed|15866923]
Protein family
[wiki|Metallo-dependent hydrolases superfamily] (according to UniProt)
Structure
[PDB|3QY7] [Pubmed|21605684]
Expression and Regulation
Operons
genes
[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]-[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]-[gene|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|ugd]
description
[Pubmed|20815827,12970183]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [Pubmed|26283769], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|26283769], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20815827], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]→[gene|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|ugd]

2021-10-18 16:10:39

ghost

8

c2e9da4a42fde0cc0e5b798663a12ae407bf7d28

23621A956181A8BE93792267290B609197EA8EF4

Biological materials
Mutant
MGNA-A077 (ywqE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/77 NBRP B. subtilis, Japan]
GP1609 (spc), available in [wiki| Jörg Stülke]'s lab
GP1610 (''[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]'', spc), available in [wiki| Jörg Stülke]'s lab
BKE36240 (Δ[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTAGCCCCCTTTTT,  downstream forward: _UP4_TAACAGCCGATTCTCATTTC
BKK36240 (Δ[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTAGCCCCCTTTTT,  downstream forward: _UP4_TAACAGCCGATTCTCATTTC
References
15866923,12970183,21605684,20815827,21605684,20817675,26283769,27148221

CF73D86DB024575BE8F043A4C3996458F4262E46

Page visits: 2565

Time of last update: 2021-10-19 09:32:45

Author of last update: Melvin.boenninger