SubtiWiki SubtiWiki
reoY

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

reoY
168

effector protein of [protein|DA763F7C2192655C590752C2A285ADF902B11BCA|murAA] degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]

locus
BSU_22580
Molecular weight
21.22 kDa
pI
5.88
Protein length
Gene length
function
control of peptidoglycan biosynthesis
product
regulator of [protein|DA763F7C2192655C590752C2A285ADF902B11BCA|murAA] degradation
essential
no
synonyms
reoY, ypiB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5582

This gene is a member of the following regulons

Gene
Coordinates
2,365,736 → 2,366,275
Phenotypes of a mutant
accumulation of [protein|DA763F7C2192655C590752C2A285ADF902B11BCA|murAA] due to reduced degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] [pubmed|32469310]
The protein
Protein family
UPF0302 family (single member, according to UniProt)
Structure
[PDB|3DO9] (from B. anthracis, 64% identity)
Expression and Regulation
Operons
genes
[gene|057BFF91609C918CEE4E6FF9100A1E4959BF6715|ypiA]-[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]
description
[Pubmed|22383849]
Open in new tab

[gene|057BFF91609C918CEE4E6FF9100A1E4959BF6715|ypiA]→[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]

2021-10-03 04:54:03

Jstuelk

1

4a0890814c10451867bc3c59ee4a82aa81eff6e8

585D8E9E9CD132F673A3DEF40B9A5AFA92A4E81F

genes
[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]
description
[Pubmed|22383849]
Open in new tab

[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]

2021-10-11 05:47:05

Jstuelk

1

e528acd95ed5c85eff49f71ea9d9630352314d3d

63DE3F8E5E6F49316A267132795483886205715F

Biological materials
Mutant
MGNA-A408 (ypiB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/408 NBRP B. subtilis, Japan]
BKE22580 (Δ[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAATTCCCTCCTCTAT,  downstream forward: _UP4_TAATATGACCAGCCTTGCAG
BKK22580 (Δ[gene|CDBBCB467FE9442B3CE45CF9401C609295E1B99F|reoY]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22580 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAATTCCCTCCTCTAT,  downstream forward: _UP4_TAATATGACCAGCCTTGCAG
References
Research papers
32469310

CDBBCB467FE9442B3CE45CF9401C609295E1B99F

Page visits: 848

Time of last update: 2021-10-21 07:30:17

Author of last update: Jstuelk