SubtiWiki SubtiWiki
glnP
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

glnP
168

glutamine [wiki|ABC transporter] (membrane protein)

locus
BSU_27460
Molecular weight
24.02 kDa
pI
7.17
Protein length
Gene length
function
glutamine uptake
product
glutamine [wiki|ABC transporter] (membrane protein)
essential
no
synonyms
glnP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0765

This gene is a member of the following regulons

Gene
Coordinates
2,804,657 → 2,805,313
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 19-210) (according to UniProt)
Structure
[PDB|4YMS] (complex with [protein|6CE6AFDBE85974B45041DE924A09CC9F56ED79D8|glnM]; from ''Thermoanaerobacter tengcongensis '', 31% identity) [Pubmed|25848002]
Paralogous protein(s)
[protein|6CE6AFDBE85974B45041DE924A09CC9F56ED79D8|glnM]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|glnQ]-[gene|BAB70547672C855AEB3A4D4624044340CF582848|glnH]-[gene|6CE6AFDBE85974B45041DE924A09CC9F56ED79D8|glnM]-[gene|CD32011A08697B2C121996A02F1BD7BE4F932778|glnP]
description
[Pubmed|12823818]
regulation
expressed during sporulation ([protein|search|SigE]) [Pubmed|15699190]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|12823818], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|glnQ]→[gene|CD32011A08697B2C121996A02F1BD7BE4F932778|glnP]

2021-07-25 17:19:07

ghost

4

4172b67953cd9774739943179aa7618cd8e9295d

48B5890726B516055A8D7439135EF79C5202B0FE

Biological materials
Mutant
BKE27460 (Δ[gene|CD32011A08697B2C121996A02F1BD7BE4F932778|glnP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GAAATCCAATGTAACTCACT,  downstream forward: _UP4_TAGAAAAGGATACTCTTTGG
BKK27460 (Δ[gene|CD32011A08697B2C121996A02F1BD7BE4F932778|glnP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GAAATCCAATGTAACTCACT,  downstream forward: _UP4_TAGAAAAGGATACTCTTTGG
References
10092453,25755103,12823818,15699190,25848002,20023025,29432725

CD32011A08697B2C121996A02F1BD7BE4F932778

Page visits: 2320

Time of last update: 2021-09-18 22:01:56

Author of last update: Melvin.boenninger